• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Fagopyrum Esculentum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAAGCAGAGAGACCCGCGCACCCGTTCTCAAACACCCCCGCGGAGGGCCTCCCCCGATCCTATCCTAGGAGAGGAGGAGGTCCCCCGCGGCGCCGGAAGGGCGAGCTCCCCCGAAACACCAAGTACGGCGGGCAGACCCCGAAGGCCATAACGAACCCCGGCGCGGACTGCGCCAAGGACCACGAACAGAAGCGCGTCCCGAGCCTCCCGGTCCCCGGGCGGCACGGCGGCGTCGCGTCGTTTCTACGAAACAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCCGGCTGAGGGCACGCCTGTCTGGGCGTCACGCACCGCGTCGCCCCCTCCCCCTCCTTCCTAAGGGAAGGTTCGGGGCAAGGGGCGGACAGTGGCCCCCCGTGCGTCCCCGCGCGGCCGGCCTAAACGCAAACCCCGTGGCCGCGAACGGCCGCGACGATTGGTGGAGTACTAAGACTACGCATCGCGTCGCGTCGCCGCGAGCCCCGGGAGGAAAGACCCGAGAGAGCCTTTTATTTAAAAGGCTCTCCGACCAACCG

Click for details-----ITS1

CGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAAGCAGAGAGACCCGCGCACCCGTTCTCAAACACCCCCGCGGAGGGCCTCCCCCGATCCTATCCTAGGAGAGGAGGAGGTCCCCCGCGGCGCCGGAAGGGCGAGCTCCCCCGAAACACCAAGTACGGCGGGCAGACCCCGAAGGCCATAACGAACCCCGGCGCGGACTGCGCCAAGGACCACGAACAGAAGCGCGTCCCGAGCCTCCCGGTCCCCGGGCGGCACGGCGGCGTCGCGTCGTTTCTACGAAACAGAA

Click for details-----ITS2

ACCGCGTCGCCCCCTCCCCCTCCTTCCCAAGGGAAAGGTCGGGGCAAGGGGCGGACAGTGGCCCCCCGTGCGTCCCCGCGCGGCCGGCCTAAACGCAAACCCCGTGGCCGCGAACGGCCGCGACGATTGGTGGAGTACTAAGACTACGCATCGCGTCGCGTCGCCGCGAGCCCCTGGAGGAAATGTTTCCGGAGAGCCTCGGCTCCCCGACCAACCGTTGCGACCCCAGATCAGA
Taxonomic Information

Plant ID: NPO26343
Plant Latin Name: Fagopyrum Esculentum
Taxonomy Genus: Fagopyrum
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 3617
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Madagascar; Angola; South Africa; Tanzania; India; Zimbabwe; Rwanda; Swaziland; Kenya; Thailand; South Korea; China

Traditional Medicine System:
Indian Folk; TCM; Homeopathy


Medicinal Functions:

Acrid; Astringent; Galactogogue; Vasodilator

Geographical Distribution

Madagascar; Angola; South Africa; Tanzania; India; Zimbabwe; Rwanda; China; Swaziland; Thailand; Kenya; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

139 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


90 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

72 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98163

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC91495

Ingredient ID: NPC8747

Ingredient ID: NPC85813

Ingredient ID: NPC81340

Ingredient ID: NPC81010

Ingredient ID: NPC66352

Ingredient ID: NPC62469

Ingredient ID: NPC62045

Ingredient ID: NPC61066

Ingredient ID: NPC60175

Ingredient ID: NPC60151

Ingredient ID: NPC59650

Ingredient ID: NPC55412

Ingredient ID: NPC49103

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490321

Ingredient ID: NPC490288

Ingredient ID: NPC489907

Ingredient ID: NPC489877

Ingredient ID: NPC48623

Ingredient ID: NPC38779

Ingredient ID: NPC37819

Ingredient ID: NPC36999

Ingredient ID: NPC328740

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC315669

Ingredient ID: NPC313955

Ingredient ID: NPC309697

Ingredient ID: NPC301696

Ingredient ID: NPC301583

Ingredient ID: NPC299625

Ingredient ID: NPC29601

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC290319

Ingredient ID: NPC288840

Ingredient ID: NPC285322

Ingredient ID: NPC282031

Ingredient ID: NPC281686

Ingredient ID: NPC279026

Ingredient ID: NPC278976

Ingredient ID: NPC278010

Ingredient ID: NPC27633

Ingredient ID: NPC275463

Ingredient ID: NPC272614

Ingredient ID: NPC272343

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC265305

Ingredient ID: NPC264493

Ingredient ID: NPC261831

Ingredient ID: NPC254848

Ingredient ID: NPC254474

Ingredient ID: NPC253509

Ingredient ID: NPC248955

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC230301

Ingredient ID: NPC228978

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225098

Ingredient ID: NPC224259

Ingredient ID: NPC223695

Ingredient ID: NPC219143

Ingredient ID: NPC218109

Ingredient ID: NPC216714

Ingredient ID: NPC214502

Ingredient ID: NPC213876

Ingredient ID: NPC209971

Ingredient ID: NPC209054

Ingredient ID: NPC208793

Ingredient ID: NPC208450

Ingredient ID: NPC20791

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC20045

Ingredient ID: NPC199072

Ingredient ID: NPC192402

Ingredient ID: NPC189436

Ingredient ID: NPC188563

Ingredient ID: NPC188428

Ingredient ID: NPC185755

Ingredient ID: NPC17810

Ingredient ID: NPC1769

Ingredient ID: NPC176740

Ingredient ID: NPC174246

Ingredient ID: NPC171188

Ingredient ID: NPC168326

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC167072

Ingredient ID: NPC165967

Ingredient ID: NPC162742

Ingredient ID: NPC162547

Ingredient ID: NPC158306

Ingredient ID: NPC158079

Ingredient ID: NPC157410

Ingredient ID: NPC156655

Ingredient ID: NPC155185

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC1507

Ingredient ID: NPC147983

Ingredient ID: NPC142753

Ingredient ID: NPC142000

Ingredient ID: NPC141765

Ingredient ID: NPC140310

Ingredient ID: NPC139891

Ingredient ID: NPC139493

Ingredient ID: NPC137958

Ingredient ID: NPC136014

Ingredient ID: NPC134616

Ingredient ID: NPC133746

Ingredient ID: NPC130683

Ingredient ID: NPC13059

Ingredient ID: NPC126681

Ingredient ID: NPC126409

Ingredient ID: NPC124436

Ingredient ID: NPC120649

Ingredient ID: NPC117238

Ingredient ID: NPC116622

Ingredient ID: NPC11609

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC112890

Ingredient ID: NPC111897

Ingredient ID: NPC110899

Ingredient ID: NPC108779

Ingredient ID: NPC10781

Ingredient ID: NPC106547

Ingredient ID: NPC1042