• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Trifolium Resupinatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGAAGCCTCTTGCCAATTTCCTTTTGATAGGTGTTGTGCGTGGGGAAAGTTGGCCTCCCGTGAGCTCCATTGTCTCATGGTTGGTTGAAAAATCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGCTGTGTCACGCACGAGACCAAATCATGTGCTGCTCTATTGAATTTTAGCCCTCTTTTTACCCCACATGCGTTTCTAAAACGCTCGTG
Taxonomic Information

Plant ID: NPO26341
Plant Latin Name: Trifolium Resupinatum
Taxonomy Genus: Trifolium
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 97036
Plant-of-the-World-Online: 523627-1

Used in Medicines

Unknown.

Geographical Distribution

Turkey; Afghanistan; Italy; Turkmenistan; France; Argentina; Uzbekistan; Australia; Iran; Algeria; Germany; Belgium; Iraq; Spain; Ukraine; Eritrea; Netherlands; Libya; United States; Morocco; Belarus; Switzerland; New Zealand; Russia; Bulgaria; Pakistan; Romania; Albania; Angola; Portugal; South Africa; Egypt; Tajikistan; Uruguay; India; United Kingdom; Tunisia; Austria; Greece; Hungary; Cyprus

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

36 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


17 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

17 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC91887

Ingredient ID: NPC90246

Ingredient ID: NPC78757

Ingredient ID: NPC7013

Ingredient ID: NPC50615

Ingredient ID: NPC44462

Ingredient ID: NPC39426

Ingredient ID: NPC31834

Ingredient ID: NPC300

Ingredient ID: NPC299096

Ingredient ID: NPC28592

Ingredient ID: NPC259370

Ingredient ID: NPC259078

Ingredient ID: NPC242414

Ingredient ID: NPC236906

Ingredient ID: NPC234560

Ingredient ID: NPC230028

Ingredient ID: NPC22560

Ingredient ID: NPC207218

Ingredient ID: NPC200636

Ingredient ID: NPC194856

Ingredient ID: NPC186560

Ingredient ID: NPC186397

Ingredient ID: NPC18457

Ingredient ID: NPC157284

Ingredient ID: NPC144247

Ingredient ID: NPC141650

Ingredient ID: NPC135193

Ingredient ID: NPC133970

Ingredient ID: NPC120102

Ingredient ID: NPC119224

Ingredient ID: NPC117992

Ingredient ID: NPC116304

Ingredient ID: NPC114333

Ingredient ID: NPC110899

Ingredient ID: NPC105881