• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Ginkgo Biloba


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ATGGTCCCGACATCCATAAGAAGGAATGGGGCACGACGAACTGGTGGGGCATAAGGGACAACCCACCAGGCGTCTGTCCATCTCCACCCTCCGATCGCCAATTACACGGGGATTGGCAGTGTAGTCATCCGATTGGTAAGGATGCACCCTTTGTCCCATAGGATTGTGGGATGGACCCCCAACCCGCTGTCTAGCCGTCGCTACCCTCCGTTCGAGAATAGCTAGAGGCGGGGATTGGTAACGTGATCGTCCAGAGGGTAAGGTCTATCCTTCAACCCGAGCTCCGGATGTGAAGGTCGCTGGACCATCGTCCGTCGAGCCCCGCCCCTTATGTTAGCAGCGCAGAGGCTCGGGCTGGCGGTCAGGAAGGATGTGCCCGAAGCTCTGGAGCTATAAATCGAGTTGTTTGGGTTTGCTAGGCTAGCCTGTTCCCCCCCGTATGGCGTCCAACACGCATCTAGCTTAAGCAACCAGATGTGGTAGTGGGTAGGGCGGACGGTAGCTGCGTACTCCTGCTTCTCGCATTTCCTCTTGGCGGATCGACAACGGGAAGAGTCATGTTTGCTCTCCTCTCGACGGTCACCTCGTGGCATGGGGAGTGTGCTCTTTCATCGTAGCGGTGTTGTTCGAGGTTGTCGCACATCGGTCGCCATGGGGAAATGGGTAACCCTTTTTTTTCCCTCCCTTCTATTCTTATCTCTTTTTTCTTATTCCCCCATGCGGAGGCACCAAGTTAAGAAAGTCGTACAGACTCCTCTGCCATGCGGGGGGGACACGCGACACCAAAGACCCTCACGACTCTCGGCAACGGATATCTTGGCTCTTACCACGATGAAGAACGTAACGAAATGCGATATTTAGTGTGAATTGTAGAATCCCATGAATCATCAAGTCTTTGAACGCAAGTTGTGGCCGAGGCTGGTGAGGGCACATCTACTTTGGCATTGCATAACTAATCACCCCCCACCCTTGGCGCGGGAGCGAGCTGGTCATTCGTGCCCCCAGTGGCGATGGTCATCTAAAAACCACGTGGTCGTCGTCTCTCGTCATTAGCGAGTGGTTTCCAGGTTGCGCGGTACACGGTTGATCGGTGTCGGCTGGGAGTATCTGGAAATCGTCTCCAAGAATAACTTCAAACTCCGGGCTCGGTCACACCATGAAAGCGGGGTGACCATCCGGATGCTGCTC

Click for details-----ITS1

ATGGTCCCGACATCCATAAGAAGGAATGGGGCACGACGAACTGGTGGGGCATAAGGGACAACCCACCAGGCGTCTGTCCATCTCCACCCTCCGATCGCCAATTACACGGGGATTGGCAGTGTAGTCATCCGATTGGTAAGGATGCACCCTTTGTCCCATAGGATTGTGGGATGGACCCCCAACCCGCTGTCTAGCCGTCGCTACCCTCCGTTCGAGAATAGCTAGAGGCGGGGATTGGTAACGTGATCGTCCAGAGGGTAAGGTCTATCCTTCAACCCGAGCTCCGGATGTGAAGGTCGCTGGACCATCGTCCGTCGAGCCCCGCCCCTTATGTTAGCAGCGCAGAGGCTCGGGCTGGCGGTCAGGAAGGATGTGCCCGAAGCTCTGGAGCTATAAATCGAGTTGTTTGGGTTTGCTAGGCTAGCCTGTTCCCCCCCGTATGGCGTCCAACACGCATCTAGCTTAAGCAACCAGATGTGGTAGTGGGTAGGGCGGACGGTAGCTGCGTACTCCTGCTTCTCGCATTTCCTCTTGGCGGATCGACAACGGGAAGAGTCATGTTTGCTCTCCTCTCGACGGTCACCTCGTGGCATGGGGAGTGTGCTCTTTCATCGTAGCGGTGTTGTTCGAGGTTGTCGCACATCGGTCGCCATGGGGAAATGGGTAACCCTTTTTTTTCCCTCCCTTCTATTCTTATCTCTTTTTTCTTATTCCCCCATGCGGAGGCACCAAGTTAAGAAAGTCGTACAGACTCCTCTGCCATGCGGGGGGGACACGCGACACCAAAGACCCTCA

Click for details-----ITS2

AACCTATCGCCCCCCGCCCTCCGGGTGCGGGGGCGCGGAGTTGGCCGTCCGTGCCCCCAGCGGCGCGGTCGGCTGAAAACCACGCGGTCGTCGTCTCTCTGCGCCGGCGAACGGTGTCCGGGCCGCGCGATGCGCGGTCGATCGGCGCCGGCGCGGAGCATCGGGCGAGCGTCTCCGCGAACAACTTCGAACTCCGGCCTCGGCCGCACCGCGCACGCGGGGCGGCCGTCCGGACGCTGCG
Taxonomic Information

Plant ID: NPO26293
Plant Latin Name: Ginkgo Biloba
Taxonomy Genus: Ginkgo
Taxonomy Family: Ginkgoaceae

Plant External Links:

NCBI TaxonomyDB: 3311
Plant-of-the-World-Online: 262125-1

Used in Medicines

Country/Region:
Thailand; South Korea; Indonesia; India

Traditional Medicine System:
TCM


Medicinal Functions:

Antianxiety; Antiasthmatic; Antibacterial; Antifungal; Astringent; Cancer; Digestive; Expectorant; Infertility; Ophthalmic; Sedative; Tonic; Vermifuge

Geographical Distribution

South Africa; Indonesia; India; United States; China; Thailand; Japan; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

338 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


214 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

181 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98661

Ingredient ID: NPC97469

Ingredient ID: NPC94502

Ingredient ID: NPC94293

Ingredient ID: NPC94167

Ingredient ID: NPC94139

Ingredient ID: NPC93888

Ingredient ID: NPC93730

Ingredient ID: NPC93617

Ingredient ID: NPC89042

Ingredient ID: NPC88890

Ingredient ID: NPC88759

Ingredient ID: NPC85813

Ingredient ID: NPC85473

Ingredient ID: NPC84811

Ingredient ID: NPC81010

Ingredient ID: NPC78770

Ingredient ID: NPC78265

Ingredient ID: NPC75945

Ingredient ID: NPC75686

Ingredient ID: NPC75353

Ingredient ID: NPC74059

Ingredient ID: NPC7208

Ingredient ID: NPC71339

Ingredient ID: NPC71061

Ingredient ID: NPC70744

Ingredient ID: NPC68889

Ingredient ID: NPC67761

Ingredient ID: NPC6717

Ingredient ID: NPC6516

Ingredient ID: NPC63562

Ingredient ID: NPC62927

Ingredient ID: NPC62044

Ingredient ID: NPC61480

Ingredient ID: NPC61477

Ingredient ID: NPC61366

Ingredient ID: NPC60735

Ingredient ID: NPC59314

Ingredient ID: NPC57690

Ingredient ID: NPC57338

Ingredient ID: NPC55786

Ingredient ID: NPC5326

Ingredient ID: NPC52955

Ingredient ID: NPC52238

Ingredient ID: NPC52005

Ingredient ID: NPC51758

Ingredient ID: NPC50898

Ingredient ID: NPC50043

Ingredient ID: NPC49894

Ingredient ID: NPC49015

Ingredient ID: NPC48629

Ingredient ID: NPC48508

Ingredient ID: NPC47993

Ingredient ID: NPC47844

Ingredient ID: NPC45079

Ingredient ID: NPC44083

Ingredient ID: NPC43728

Ingredient ID: NPC42760

Ingredient ID: NPC39635

Ingredient ID: NPC39426

Ingredient ID: NPC39360

Ingredient ID: NPC36498

Ingredient ID: NPC35856

Ingredient ID: NPC34908

Ingredient ID: NPC33667

Ingredient ID: NPC33372

Ingredient ID: NPC32977

Ingredient ID: NPC329156

Ingredient ID: NPC328788

Ingredient ID: NPC328180

Ingredient ID: NPC323434

Ingredient ID: NPC321160

Ingredient ID: NPC32021

Ingredient ID: NPC311430

Ingredient ID: NPC311000

Ingredient ID: NPC308843

Ingredient ID: NPC307783

Ingredient ID: NPC306207

Ingredient ID: NPC303712

Ingredient ID: NPC303485

Ingredient ID: NPC302857

Ingredient ID: NPC302637

Ingredient ID: NPC302003

Ingredient ID: NPC301708

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC300969

Ingredient ID: NPC300346

Ingredient ID: NPC300326

Ingredient ID: NPC300206

Ingredient ID: NPC299856

Ingredient ID: NPC299545

Ingredient ID: NPC29883

Ingredient ID: NPC296256

Ingredient ID: NPC294902

Ingredient ID: NPC294815

Ingredient ID: NPC294548

Ingredient ID: NPC294389

Ingredient ID: NPC293628

Ingredient ID: NPC292803

Ingredient ID: NPC292665

Ingredient ID: NPC291473

Ingredient ID: NPC291428

Ingredient ID: NPC290768

Ingredient ID: NPC290613

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC289584

Ingredient ID: NPC287876

Ingredient ID: NPC287301

Ingredient ID: NPC285731

Ingredient ID: NPC285322

Ingredient ID: NPC284574

Ingredient ID: NPC283823

Ingredient ID: NPC28274

Ingredient ID: NPC282465

Ingredient ID: NPC279121

Ingredient ID: NPC278028

Ingredient ID: NPC277907

Ingredient ID: NPC277391

Ingredient ID: NPC27699

Ingredient ID: NPC276325

Ingredient ID: NPC275255

Ingredient ID: NPC273330

Ingredient ID: NPC272614

Ingredient ID: NPC272454

Ingredient ID: NPC26974

Ingredient ID: NPC268342

Ingredient ID: NPC268266

Ingredient ID: NPC268221

Ingredient ID: NPC267649

Ingredient ID: NPC265885

Ingredient ID: NPC265624

Ingredient ID: NPC263439

Ingredient ID: NPC262926

Ingredient ID: NPC261619

Ingredient ID: NPC261038

Ingredient ID: NPC250436

Ingredient ID: NPC250069

Ingredient ID: NPC249524

Ingredient ID: NPC249045

Ingredient ID: NPC248355

Ingredient ID: NPC248056

Ingredient ID: NPC245346

Ingredient ID: NPC245027

Ingredient ID: NPC244994

Ingredient ID: NPC241144

Ingredient ID: NPC239737

Ingredient ID: NPC238254

Ingredient ID: NPC237812

Ingredient ID: NPC237532

Ingredient ID: NPC234970

Ingredient ID: NPC234205

Ingredient ID: NPC234133

Ingredient ID: NPC231772

Ingredient ID: NPC230861

Ingredient ID: NPC230301

Ingredient ID: NPC229559

Ingredient ID: NPC229249

Ingredient ID: NPC226453

Ingredient ID: NPC226265

Ingredient ID: NPC226087

Ingredient ID: NPC226027

Ingredient ID: NPC225434

Ingredient ID: NPC224941

Ingredient ID: NPC224605

Ingredient ID: NPC223697

Ingredient ID: NPC223424

Ingredient ID: NPC222743

Ingredient ID: NPC22153

Ingredient ID: NPC220825

Ingredient ID: NPC220173

Ingredient ID: NPC219981

Ingredient ID: NPC219876

Ingredient ID: NPC219143

Ingredient ID: NPC218168

Ingredient ID: NPC218109

Ingredient ID: NPC216630

Ingredient ID: NPC21535

Ingredient ID: NPC213758

Ingredient ID: NPC21290

Ingredient ID: NPC212198

Ingredient ID: NPC211995

Ingredient ID: NPC211913

Ingredient ID: NPC211267

Ingredient ID: NPC210003

Ingredient ID: NPC209279

Ingredient ID: NPC208793

Ingredient ID: NPC20791

Ingredient ID: NPC204820

Ingredient ID: NPC203980

Ingredient ID: NPC203468

Ingredient ID: NPC203440

Ingredient ID: NPC203259

Ingredient ID: NPC202764

Ingredient ID: NPC201632

Ingredient ID: NPC199729

Ingredient ID: NPC197396

Ingredient ID: NPC197376

Ingredient ID: NPC197087

Ingredient ID: NPC196776

Ingredient ID: NPC196676

Ingredient ID: NPC196359

Ingredient ID: NPC195987

Ingredient ID: NPC194593

Ingredient ID: NPC194586

Ingredient ID: NPC193989

Ingredient ID: NPC192173

Ingredient ID: NPC192

Ingredient ID: NPC191801

Ingredient ID: NPC190184

Ingredient ID: NPC188867

Ingredient ID: NPC188383

Ingredient ID: NPC188312

Ingredient ID: NPC187770

Ingredient ID: NPC187615

Ingredient ID: NPC18603

Ingredient ID: NPC185538

Ingredient ID: NPC18433

Ingredient ID: NPC184078

Ingredient ID: NPC183993

Ingredient ID: NPC183730

Ingredient ID: NPC18335

Ingredient ID: NPC182197

Ingredient ID: NPC18188

Ingredient ID: NPC181465

Ingredient ID: NPC1813

Ingredient ID: NPC181153

Ingredient ID: NPC180871

Ingredient ID: NPC18044

Ingredient ID: NPC179950

Ingredient ID: NPC179092

Ingredient ID: NPC17817

Ingredient ID: NPC17810

Ingredient ID: NPC177518

Ingredient ID: NPC176740

Ingredient ID: NPC174321

Ingredient ID: NPC174246

Ingredient ID: NPC173638

Ingredient ID: NPC173637

Ingredient ID: NPC173582

Ingredient ID: NPC173208

Ingredient ID: NPC172494

Ingredient ID: NPC171736

Ingredient ID: NPC170739

Ingredient ID: NPC170475

Ingredient ID: NPC169749

Ingredient ID: NPC169089

Ingredient ID: NPC168528

Ingredient ID: NPC168303

Ingredient ID: NPC167976

Ingredient ID: NPC165967

Ingredient ID: NPC163105

Ingredient ID: NPC162620

Ingredient ID: NPC162282

Ingredient ID: NPC161334

Ingredient ID: NPC159900

Ingredient ID: NPC15970

Ingredient ID: NPC158537

Ingredient ID: NPC158306

Ingredient ID: NPC157410

Ingredient ID: NPC15698

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC155865

Ingredient ID: NPC155788

Ingredient ID: NPC155187

Ingredient ID: NPC154962

Ingredient ID: NPC153696

Ingredient ID: NPC152452

Ingredient ID: NPC152451

Ingredient ID: NPC151112

Ingredient ID: NPC150908

Ingredient ID: NPC149746

Ingredient ID: NPC149184

Ingredient ID: NPC149155

Ingredient ID: NPC147310

Ingredient ID: NPC14606

Ingredient ID: NPC140983

Ingredient ID: NPC140420

Ingredient ID: NPC139546

Ingredient ID: NPC139053

Ingredient ID: NPC138299

Ingredient ID: NPC137958

Ingredient ID: NPC137717

Ingredient ID: NPC134532

Ingredient ID: NPC133671

Ingredient ID: NPC132307

Ingredient ID: NPC132304

Ingredient ID: NPC131623

Ingredient ID: NPC127546

Ingredient ID: NPC127423

Ingredient ID: NPC126925

Ingredient ID: NPC126029

Ingredient ID: NPC126004

Ingredient ID: NPC125062

Ingredient ID: NPC123474

Ingredient ID: NPC123070

Ingredient ID: NPC122493

Ingredient ID: NPC121497

Ingredient ID: NPC119107

Ingredient ID: NPC119090

Ingredient ID: NPC118930

Ingredient ID: NPC118013

Ingredient ID: NPC116775

Ingredient ID: NPC116709

Ingredient ID: NPC116190

Ingredient ID: NPC115723

Ingredient ID: NPC114920

Ingredient ID: NPC114365

Ingredient ID: NPC11433

Ingredient ID: NPC113733

Ingredient ID: NPC112890

Ingredient ID: NPC112889

Ingredient ID: NPC111888

Ingredient ID: NPC110942

Ingredient ID: NPC110906

Ingredient ID: NPC110765

Ingredient ID: NPC110673

Ingredient ID: NPC108831

Ingredient ID: NPC108494

Ingredient ID: NPC108358

Ingredient ID: NPC107991

Ingredient ID: NPC10781

Ingredient ID: NPC1075

Ingredient ID: NPC107373

Ingredient ID: NPC106780

Ingredient ID: NPC106551

Ingredient ID: NPC10568

Ingredient ID: NPC104495

Ingredient ID: NPC103911

Ingredient ID: NPC103213

Ingredient ID: NPC102803

Ingredient ID: NPC102449

Ingredient ID: NPC101488

Ingredient ID: NPC100648

Ingredient ID: NPC100128