• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Euphorbia Hirta


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTCCGTAGGTGAACCTGCGGAAGTGATCATTGTCGAAACCTGCCCAGCAGAACGACCTGTGAACGTGTTATTAAAACGAGGGGTCCGAAGCGGGTTTTACCAGCCTTGGCCCTTCACCGGGCCTTGATCGGGGTATCCGGGCGTGCAGGCTTGTCCTTCAATCCCGGACCGTCCCGGTCTTGGCTTGCTAACAAACCCCCGGCGCGGAAAGCGCCAAGGAATTGCAAACAGAAAGATCGGGCACTCCGACTGCCCCGGAAACGGTGTGCAACAGGAATGCTCCGTGCTTTTAAAATCTAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGGATCCCGCGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGTGTCACTCAACGTCGCCCCAACCTCCTCATTGCAGGACGGGGGCGGAATATGGCCTCCCGTGTGCTCATCCCACGCGGTTGGCCCAAATGTCCGGTCCACGGCAACGACGCCACGGCAATCGGTGGTTGTATGGCCCTCGCTAAATGTCGTGAGTGATCGGGTTTGAGGGACTTAAAAGGCCCCGTAGCGTATCTGATGAGGCGCTCGCAATGCGACCTCCAGGTCAGGCGGTTTCCTTCCCCTGGGG

Click for details-----ITS1

TTCCGTAGGTGAACCTGCGGAAGTGATCATTGTCGAAACCTGCCCAGCAGAACGACCTGTGAACGTGTTATTAAAACGAGGGGTCCGAAGCGGGTTTTACCAGCCTTGGCCCTTCACCGGGCCTTGATCGGGGTATCCGGGCGTGCAGGCTTGTCCTTCAATCCCGGACCGTCCCGGTCTTGGCTTGCTAACAAACCCCCGGCGCGGAAAGCGCCAAGGAATTGCAAACAGAAAGATCGGGCACTCCGACTGCCCCGGAAACGGTGTGCAACAGGAATGCTCCGTGCTTTTAAAATCTAAA

Click for details-----ITS2

AACGTCGCCCCAACCTCCTCATTGCAGGACGGGGGCGGAATATGGCCTCCCGTGTGCTCATCCCACGCGGTTGGCCCAAATGTCCGGTCCACGGCAACGACGCCACGGCAATCGGTGGTTGTATGGCCCTCGCTAAATGTCGTGAGTGATCGGGTTTGAGGGACTTAAAAGGCCCCGTAGCGTATCTGATGAGGCGCTCGCAATGCGACCTCCAGGTCAGGCGGTTTCCTTCCCCTGGGG
Taxonomic Information

Plant ID: NPO26277
Plant Latin Name: Euphorbia Hirta
Taxonomy Genus: Euphorbia
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: 318062
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Ghana; Guinea; Tanzania; Indonesia; India; Rwanda; China; Kenya; Nigeria; Bolivia; Burkina Faso

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Anodyne; Antiasthmatic; Antipruritic; Carminative; Depurative; Diuretic; Febrifuge; Galactogogue; Purgative; VD; Vermifuge; Warts

Geographical Distribution

Ghana; Guinea; Tanzania; Indonesia; India; Rwanda; China; Kenya; Nigeria; Bolivia; Burkina Faso

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

144 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


89 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

83 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97432

Ingredient ID: NPC92747

Ingredient ID: NPC9099

Ingredient ID: NPC85946

Ingredient ID: NPC85346

Ingredient ID: NPC84529

Ingredient ID: NPC83692

Ingredient ID: NPC836

Ingredient ID: NPC80237

Ingredient ID: NPC80064

Ingredient ID: NPC79943

Ingredient ID: NPC79653

Ingredient ID: NPC7813

Ingredient ID: NPC76336

Ingredient ID: NPC7542

Ingredient ID: NPC70388

Ingredient ID: NPC67209

Ingredient ID: NPC6682

Ingredient ID: NPC65897

Ingredient ID: NPC63941

Ingredient ID: NPC61477

Ingredient ID: NPC58478

Ingredient ID: NPC54733

Ingredient ID: NPC53545

Ingredient ID: NPC48623

Ingredient ID: NPC482342

Ingredient ID: NPC482341

Ingredient ID: NPC482340

Ingredient ID: NPC482339

Ingredient ID: NPC482338

Ingredient ID: NPC482337

Ingredient ID: NPC482336

Ingredient ID: NPC482335

Ingredient ID: NPC482334

Ingredient ID: NPC482333

Ingredient ID: NPC482332

Ingredient ID: NPC482331

Ingredient ID: NPC482330

Ingredient ID: NPC482329

Ingredient ID: NPC482328

Ingredient ID: NPC482327

Ingredient ID: NPC482326

Ingredient ID: NPC482325

Ingredient ID: NPC482324

Ingredient ID: NPC47993

Ingredient ID: NPC39633

Ingredient ID: NPC38751

Ingredient ID: NPC34855

Ingredient ID: NPC34700

Ingredient ID: NPC32441

Ingredient ID: NPC317727

Ingredient ID: NPC311485

Ingredient ID: NPC310327

Ingredient ID: NPC307699

Ingredient ID: NPC306990

Ingredient ID: NPC302857

Ingredient ID: NPC302817

Ingredient ID: NPC301585

Ingredient ID: NPC298796

Ingredient ID: NPC298436

Ingredient ID: NPC294902

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289774

Ingredient ID: NPC283655

Ingredient ID: NPC280254

Ingredient ID: NPC279121

Ingredient ID: NPC275449

Ingredient ID: NPC270283

Ingredient ID: NPC26974

Ingredient ID: NPC26960

Ingredient ID: NPC266020

Ingredient ID: NPC261619

Ingredient ID: NPC257968

Ingredient ID: NPC257189

Ingredient ID: NPC257188

Ingredient ID: NPC253989

Ingredient ID: NPC251539

Ingredient ID: NPC250436

Ingredient ID: NPC248056

Ingredient ID: NPC247553

Ingredient ID: NPC243083

Ingredient ID: NPC240722

Ingredient ID: NPC237532

Ingredient ID: NPC236749

Ingredient ID: NPC236579

Ingredient ID: NPC233384

Ingredient ID: NPC231710

Ingredient ID: NPC230301

Ingredient ID: NPC228256

Ingredient ID: NPC225710

Ingredient ID: NPC221268

Ingredient ID: NPC219876

Ingredient ID: NPC217176

Ingredient ID: NPC21601

Ingredient ID: NPC210042

Ingredient ID: NPC20791

Ingredient ID: NPC207741

Ingredient ID: NPC20742

Ingredient ID: NPC199522

Ingredient ID: NPC195672

Ingredient ID: NPC192638

Ingredient ID: NPC187770

Ingredient ID: NPC182749

Ingredient ID: NPC182102

Ingredient ID: NPC180684

Ingredient ID: NPC178134

Ingredient ID: NPC176740

Ingredient ID: NPC173637

Ingredient ID: NPC168707

Ingredient ID: NPC167976

Ingredient ID: NPC167385

Ingredient ID: NPC166347

Ingredient ID: NPC163115

Ingredient ID: NPC160512

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC156549

Ingredient ID: NPC156353

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC14636

Ingredient ID: NPC142951

Ingredient ID: NPC139548

Ingredient ID: NPC13768

Ingredient ID: NPC136176

Ingredient ID: NPC136014

Ingredient ID: NPC133966

Ingredient ID: NPC129026

Ingredient ID: NPC126029

Ingredient ID: NPC125062

Ingredient ID: NPC123965

Ingredient ID: NPC122318

Ingredient ID: NPC119381

Ingredient ID: NPC117493

Ingredient ID: NPC116775

Ingredient ID: NPC116538

Ingredient ID: NPC114179

Ingredient ID: NPC1140

Ingredient ID: NPC111929

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC106417

Ingredient ID: NPC101219