CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Anisodus Tanguticus

Example Image

PLANiTS DNA barcode

TTTTCATAGGTGAACCTACGGAAAGATCATTTTCGAAACATGCATTGCAGAATGACCCGCGAACACATTTAAACATTGGGGAGCCAAGCAGGCAGGGTTCTTCGGCCCCTCCTCTGTGCGTCTTTCTCCCGTCCCCGATGCTCGCTCACACGTGGTGGTTGACTAATGAACCCTAGTGCAGAAAGCTATAAGGAATACTAAATTGATAGTTTTCCTCTCGTGTCACGTCTGCGGTGCACGCGGGAGGACCTATGCTTCTTTTGAAACAATAA

Click for details-----ITS2

ATCGCGTCGCCCCCGCACGCCGCGCCCGCCATGCGGGACGCGGCGGTGTCGCGGGGCGGATACTGGCCTCCCGTGCGCCTCGAGCTCGCGGCCGGCCTAAATGCGGGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTGACCCAACTCTCGTGCTGTCGCGGCTGTAGCCCGTCGCGCGTTCGGACTCCCGGACCCTCTTTGCGCTC

Taxonomic Information

Plant ID: NPO26163
Plant Latin Name: Anisodus Tanguticus
Taxonomy Genus: Anisodus
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 243964
Plant-of-the-World-Online: 814269-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

Nepal; China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

92 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

30 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC99574

Ingredient ID: NPC94223

Ingredient ID: NPC93515

Ingredient ID: NPC91416

Ingredient ID: NPC8932

Ingredient ID: NPC85482

Ingredient ID: NPC84301

Ingredient ID: NPC84281

Ingredient ID: NPC82770

Ingredient ID: NPC7126

Ingredient ID: NPC69768

Ingredient ID: NPC68673

Ingredient ID: NPC6674

Ingredient ID: NPC65424

Ingredient ID: NPC63441

Ingredient ID: NPC59086

Ingredient ID: NPC5473

Ingredient ID: NPC50583

Ingredient ID: NPC49984

Ingredient ID: NPC48800

Ingredient ID: NPC47262

Ingredient ID: NPC44326

Ingredient ID: NPC41750

Ingredient ID: NPC40775

Ingredient ID: NPC40701

Ingredient ID: NPC38714

Ingredient ID: NPC36609

Ingredient ID: NPC3251

Ingredient ID: NPC306464

Ingredient ID: NPC304477

Ingredient ID: NPC290924

Ingredient ID: NPC287708

Ingredient ID: NPC286347

Ingredient ID: NPC283849

Ingredient ID: NPC280300

Ingredient ID: NPC277168

Ingredient ID: NPC269108

Ingredient ID: NPC268848

Ingredient ID: NPC268747

Ingredient ID: NPC252334

Ingredient ID: NPC251881

Ingredient ID: NPC250550

Ingredient ID: NPC245712

Ingredient ID: NPC243728

Ingredient ID: NPC242800

Ingredient ID: NPC242611

Ingredient ID: NPC242563

Ingredient ID: NPC241807

Ingredient ID: NPC241631

Ingredient ID: NPC234378

Ingredient ID: NPC233238

Ingredient ID: NPC229821

Ingredient ID: NPC224757

Ingredient ID: NPC217579

Ingredient ID: NPC211401

Ingredient ID: NPC208894

Ingredient ID: NPC204385

Ingredient ID: NPC198991

Ingredient ID: NPC193956

Ingredient ID: NPC188815

Ingredient ID: NPC187808

Ingredient ID: NPC187724

Ingredient ID: NPC186083

Ingredient ID: NPC180579

Ingredient ID: NPC17740

Ingredient ID: NPC175069

Ingredient ID: NPC174537

Ingredient ID: NPC173810

Ingredient ID: NPC172742

Ingredient ID: NPC171551

Ingredient ID: NPC168064

Ingredient ID: NPC166709

Ingredient ID: NPC157868

Ingredient ID: NPC153758

Ingredient ID: NPC152044

Ingredient ID: NPC14665

Ingredient ID: NPC142661

Ingredient ID: NPC140707

Ingredient ID: NPC140302

Ingredient ID: NPC139891

Ingredient ID: NPC139060

Ingredient ID: NPC137949

Ingredient ID: NPC134810

Ingredient ID: NPC133671

Ingredient ID: NPC122415

Ingredient ID: NPC119501

Ingredient ID: NPC119434

Ingredient ID: NPC116775

Ingredient ID: NPC115162

Ingredient ID: NPC111929

Ingredient ID: NPC10931

Ingredient ID: NPC105751

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 2	CYP2A6	Cytochrome P450 2A6	P11509	CHEMBL5282
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Oxidoreductase	HSD17B2	Estradiol 17-beta-dehydrogenase 2	P37059	CHEMBL2789
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM1	Muscarinic acetylcholine receptor M1	P11229	CHEMBL216
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM5	Muscarinic acetylcholine receptor M5	P08912	CHEMBL2035
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM3	Muscarinic acetylcholine receptor M3	P20309	CHEMBL245
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM2	Muscarinic acetylcholine receptor M2	P08172	CHEMBL211
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	AHR	Aryl hydrocarbon receptor	P35869	CHEMBL3201

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CHRM1,HSD17B2,CA2,CA9,CISD1,AHR,CYP1A2,CA12,CSNK2A3
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DPP4,HSD17B2,CSNK2A2,CA9,TYR,AHR,CA12,CA7,LMNA
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA14,CHRM1,CSNK2A1,CA2,CHRM5,AHR,CA12,CA9
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA14,CHRM1,DPP4,HSD17B2,CA9,CISD1,CA2,CA7
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	DPP4,CA2,CA9,CYP1B1,CA12,CSNK2A3,LMNA
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	DPP4,HSD17B2,CHRM2,CA9,CHRM3,CA12,CA7
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CSNK2A2,CA9,CISD1,AHR,CA12,LMNA
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CHRM5,CA14,CYP2C9,CHRM1,CA2,CYP1A1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP2C9,DPP4,HSD17B2,CA9,CISD1,CYP1B1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA14,CYP2C9,DPP4,HSD17B2,AHR,CA12
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CHRM1,CHRM5,CHRM3,CA2,CHRM2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CA14,CHRM1,CHRM2,CHRM3,CA2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA9,CHRM3,CA12,CA12,CA9
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP2C9,HSD17B2,CA9,CA2,CYP1A1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CHRM1,CA2,CYP1A2,CA12,CYP1A1
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12,CA14,CYP2C9,CA2
Peptic ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA61	CHRM5,CHRM2,CHRM1,CHRM3
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA14,CA12,CA2,CA9
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP2C9,CA9,TYR,CA9
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CYP2C9,CA9,CA12,CA7
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CYP2C9,CA9,CYP1A2,CA2
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,CA7,CYP1B1,DPP4
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CYP2C9,CA9,CA12,CA7
Functional bladder disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC50	CHRM3,CHRM5,CHRM1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CHRM3,CHRM2,CHRM5
Sebaceous gland disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED91	CHRM1,CHRM2,CHRM3
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	CYP2A6,DPP4,AHR
Abnormal micturition Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF50	CHRM2,CHRM1,CHRM5
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	CHRM5,CHRM1,CHRM3
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	CA9,CSNK2A3,LMNA
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9,TYR,CYP1A1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	CA2,DPP4,LMNA
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CYP2A6,CA9
Respiratory system disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB40-CB7Z	CHRM3,CHRM2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	CHRM1,CHRM5
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	CHRM3,CHRM5
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	CHRM1,CHRM5
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2,CA12
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12,HSD17B2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CHRM3,CA12
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CHRM5,CA9
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1,CA9
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CHRM5,CYP1A1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	DPP4,CYP1B1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA14,CYP2C9,DPP4,HSD17B2,CA9,CISD1,CYP1B1,CA2,CA7,LMNA
Corneal disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A76-9A78	CHRM1
Infectious gastroenteritis/colitis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A40	CHRM5
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	CHRM1
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR
Dystonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A02	CHRM1
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	DPP4
Oesophagus motility disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA21	CHRM5
Cough Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD12	CHRM5
Abdominal pelvic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD81	CHRM1
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	TYR
Mycosis fungoides Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B01	CYP2A6
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Appearance/behaviour symptom Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB23	CHRM5
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	CSNK2A1
Polyuria Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF55	CHRM5
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CHRM1
Urgency Disease Category: NA Disease ICD-11 Code: N.A.	CHRM5
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	DPP4
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	CHRM1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	CHRM5
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	DPP4
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Ureteral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C92	AHR
Central and peripheral nervous disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A04-8E7Z	CHRM5
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	CHRM1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	CHRM1
Dyslipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80-5C81	CHRM1
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	CHRM1
Muscle disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB32-FB3Z	CHRM2
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	CHRM5
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	AHR
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	CHRM1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	CHRM5
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	CHRM1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	AHR
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	CHRM5
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Epileptic encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A62	CHRM1
Brain disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70-8E61	CHRM5
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4
Sjogren syndrome Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A43	CHRM3
General examination Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QA00	CHRM5
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CA9
Gastric ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA60	CHRM1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	CA9
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Anterior uveitis Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A96	CHRM5
Gastritis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA42	CHRM5
Cognition symptoms/signs/clinical sympton Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB21	CHRM5
Pancreatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DC31-DC34	CHRM5
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	CHRM3
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	AHR
Nystagmus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C84	CHRM5
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	AHR
Hyperhidrosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EE00	CHRM1
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	CHRM5
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CHRM1
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CYP1A1
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	CYP2C9
Hypertrophic cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.1	CHRM3
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	DPP4
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	DPP4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	CYP1B1
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	HSD17B2
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AHR

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Anisodus Tanguticus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

92 All known Ingredients in Total

30 Ingredients with Acceptable Bioavailablity

20 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Serous cystadenoma,borderline malignancy of ovary

Mesothelioma of pleura

Solid tumour/cancer

Carcinosarcoma of uterus

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Diffuse large B-cell lymphomas

Cytomegaloviral disease

Malignant neoplasms of thymus

Germ cell tumour of testis

Glaucoma

Pheochromocytoma

Hepatocellular carcinoma of liver

Malignant neoplasms of corpus uteri, unspecified

Renal cell carcinoma, chromophobe type

Bacterial infection

Peptic ulcer

Breast cancer

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Urothelial carcinoma of bladder

Malignant neoplasms of thyroid gland, unspecified

Adenocarcinoma of bronchus or lung

Functional bladder disorder

Asthma

Sebaceous gland disorder

Psoriasis

Abnormal micturition

Chronic obstructive pulmonary disease

Malignant neoplasms of biliary tract, distal bile duct

Other specified malignant neoplasms ofcolon

Superficial ovarian endometriosis

Invasive carcinoma of breast

Respiratory system disease

Parkinsonism

Tonus and reflex abnormality

Irritable bowel syndrome

Seborrhoeic dermatitis

Osteoarthritis, unspecified

Hepatoblastoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms of bronchus or lung

Chronic rhinosinusitis

Systemic lupus erythematosus

Carpal tunnel syndrome

Adenocarcinoma of pancreas

Corneal disease

Infectious gastroenteritis/colitis

Mild neurocognitive disorder

Acquired hypomelanotic disorder

Dystonic disorder

Chronic arterial occlusive disease

Oesophagus motility disorder

Cough

Abdominal pelvic pain

Melanoma

Mycosis fungoides

Myocardial infarction

Appearance/behaviour symptom

Metabolic disorder

Liver cancer

Polyuria