• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pilocarpus Spicatus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCAAAACCTGCACAGCAGAACGACCCGCGAACCTGTCACAACACCGGCGGGGGGCGCGCCCCTCGGGCGCTCCTCCCCCTATCGCCGCGGGTGCGGGACTCATCCCGTTCCCCGCGGCGGACAACGAACCCCCGGCGCGGAATGCGCCAAGGAAAAAGTAACGAGAGAGCACGCTCCAGGGGCCCCGGACACGGTGCGCCTCGGGACGCGGCGCCTTCTTTCACTGTATCTATAA

Click for details-----ITS2

ATCGTTGCCCCACCCCCACCCCTCGACATCGGGGGGCCCGGCGGTGCGGGCGGAGAATGGCCTCCCGTGCGCTCCCCGCTCGCGGTTGGCCCAAATTCGAGTCCTCGGCGACCGAGGCCGCTGCGATCGGTGGTGAAATCAAGCCTCTCGAGCAAAACGCCGCGCGCCCTCGTCTCCGTTTCGGGGCTCAGGGACCCTGACGCTCCGCGCAAGCGGCGCTCGCA
Taxonomic Information

Plant ID: NPO26109
Plant Latin Name: Pilocarpus Spicatus
Taxonomy Genus: Pilocarpus
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 549430
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

79 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

15 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99574

Ingredient ID: NPC94223

Ingredient ID: NPC93515

Ingredient ID: NPC91416

Ingredient ID: NPC8932

Ingredient ID: NPC84301

Ingredient ID: NPC82770

Ingredient ID: NPC7126

Ingredient ID: NPC69768

Ingredient ID: NPC68673

Ingredient ID: NPC6674

Ingredient ID: NPC65424

Ingredient ID: NPC63441

Ingredient ID: NPC5473

Ingredient ID: NPC50583

Ingredient ID: NPC49984

Ingredient ID: NPC48800

Ingredient ID: NPC47262

Ingredient ID: NPC44326

Ingredient ID: NPC41750

Ingredient ID: NPC40775

Ingredient ID: NPC40701

Ingredient ID: NPC38714

Ingredient ID: NPC3251

Ingredient ID: NPC306464

Ingredient ID: NPC304477

Ingredient ID: NPC290924

Ingredient ID: NPC286347

Ingredient ID: NPC283849

Ingredient ID: NPC280300

Ingredient ID: NPC277168

Ingredient ID: NPC269108

Ingredient ID: NPC268848

Ingredient ID: NPC268747

Ingredient ID: NPC252334

Ingredient ID: NPC251881

Ingredient ID: NPC250550

Ingredient ID: NPC245712

Ingredient ID: NPC243728

Ingredient ID: NPC242800

Ingredient ID: NPC242563

Ingredient ID: NPC241807

Ingredient ID: NPC241631

Ingredient ID: NPC233238

Ingredient ID: NPC229821

Ingredient ID: NPC224757

Ingredient ID: NPC217579

Ingredient ID: NPC208894

Ingredient ID: NPC198991

Ingredient ID: NPC193956

Ingredient ID: NPC188815

Ingredient ID: NPC187808

Ingredient ID: NPC187724

Ingredient ID: NPC186083

Ingredient ID: NPC180579

Ingredient ID: NPC17740

Ingredient ID: NPC175069

Ingredient ID: NPC174537

Ingredient ID: NPC172742

Ingredient ID: NPC168064

Ingredient ID: NPC166709

Ingredient ID: NPC157868

Ingredient ID: NPC153758

Ingredient ID: NPC152044

Ingredient ID: NPC14665

Ingredient ID: NPC142661

Ingredient ID: NPC140707

Ingredient ID: NPC139891

Ingredient ID: NPC139060

Ingredient ID: NPC134810

Ingredient ID: NPC133671

Ingredient ID: NPC122415

Ingredient ID: NPC119501

Ingredient ID: NPC119434

Ingredient ID: NPC116775

Ingredient ID: NPC115162

Ingredient ID: NPC111929

Ingredient ID: NPC10931

Ingredient ID: NPC105751