• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Swertia Delavayi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGAAGCAGACGACCCGAGAACATGTTTAACAAACGGGTGTCCGGGACGAGGGAAACCACGGACCGGCGCCCCGAGCACGGTGTCGACCTTAGGTTGCTCGTCGTGCACACAAACAACCCCGGGCGCATAAAAGCGCCAAGGAAAACAAGAAAGGGATGGCTTGCCTCTCGACGCTCCGTTTGCGGAGTGCACGGGAGGGCAACAGGCACCTGAAGAAACAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAACTGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCAAACCCCGTGCGTTAACTTGTACGGGTGACATGAGGGGGCGGAAGCTGGCTTCCCGTGCTTGGTCGCGGCTGGCCTAAATGCGAGTCCCTTGTGACGGACGCGACGACAAGTGGTGGTTGATTGCCTCAACTAAGGTGCTGTCGCTCGACGCCCGTCGAATGAGGCAGATTCCCCGACCCTAATGCA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCCAAACCCCGTGCGTTAACTTGTACGGGTGACATGAGGGGGCGGAAGCTGGCTTCCCGTGCTTGGTCGCGGCTGGCCTAAATGCGAGTCCCTTGTGACGGACGCGACGACAAGTGGTGGTTGATTGCCTCAACTAAGGTGCTGTCGCTCGACGCCCGTCGAATGAGGCAGATTCCCCGACCCTAATGCA
Taxonomic Information

Plant ID: NPO26052
Plant Latin Name: Swertia Delavayi
Taxonomy Genus: Swertia
Taxonomy Family: Gentianaceae

Plant External Links:

NCBI TaxonomyDB: 166617
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

103 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


65 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

76 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98583

Ingredient ID: NPC95603

Ingredient ID: NPC94729

Ingredient ID: NPC93843

Ingredient ID: NPC91504

Ingredient ID: NPC88566

Ingredient ID: NPC86630

Ingredient ID: NPC8416

Ingredient ID: NPC79482

Ingredient ID: NPC78701

Ingredient ID: NPC78500

Ingredient ID: NPC78074

Ingredient ID: NPC76608

Ingredient ID: NPC76145

Ingredient ID: NPC67920

Ingredient ID: NPC67037

Ingredient ID: NPC66655

Ingredient ID: NPC65517

Ingredient ID: NPC62765

Ingredient ID: NPC62086

Ingredient ID: NPC59581

Ingredient ID: NPC58616

Ingredient ID: NPC58190

Ingredient ID: NPC57879

Ingredient ID: NPC52884

Ingredient ID: NPC5232

Ingredient ID: NPC51700

Ingredient ID: NPC49151

Ingredient ID: NPC4809

Ingredient ID: NPC46248

Ingredient ID: NPC39977

Ingredient ID: NPC38497

Ingredient ID: NPC35448

Ingredient ID: NPC34763

Ingredient ID: NPC33489

Ingredient ID: NPC32279

Ingredient ID: NPC31976

Ingredient ID: NPC312132

Ingredient ID: NPC303668

Ingredient ID: NPC294703

Ingredient ID: NPC292559

Ingredient ID: NPC286262

Ingredient ID: NPC281131

Ingredient ID: NPC279300

Ingredient ID: NPC276222

Ingredient ID: NPC275462

Ingredient ID: NPC272552

Ingredient ID: NPC271440

Ingredient ID: NPC268962

Ingredient ID: NPC268862

Ingredient ID: NPC268632

Ingredient ID: NPC268631

Ingredient ID: NPC263940

Ingredient ID: NPC262505

Ingredient ID: NPC259512

Ingredient ID: NPC256186

Ingredient ID: NPC253662

Ingredient ID: NPC249912

Ingredient ID: NPC23508

Ingredient ID: NPC226108

Ingredient ID: NPC225783

Ingredient ID: NPC216706

Ingredient ID: NPC208936

Ingredient ID: NPC20791

Ingredient ID: NPC205351

Ingredient ID: NPC202189

Ingredient ID: NPC197356

Ingredient ID: NPC193649

Ingredient ID: NPC192229

Ingredient ID: NPC188277

Ingredient ID: NPC185189

Ingredient ID: NPC18185

Ingredient ID: NPC180667

Ingredient ID: NPC179831

Ingredient ID: NPC173637

Ingredient ID: NPC171188

Ingredient ID: NPC170799

Ingredient ID: NPC168855

Ingredient ID: NPC166894

Ingredient ID: NPC164646

Ingredient ID: NPC163556

Ingredient ID: NPC161097

Ingredient ID: NPC158857

Ingredient ID: NPC157338

Ingredient ID: NPC153696

Ingredient ID: NPC149436

Ingredient ID: NPC147743

Ingredient ID: NPC141777

Ingredient ID: NPC139546

Ingredient ID: NPC138113

Ingredient ID: NPC136771

Ingredient ID: NPC1363

Ingredient ID: NPC131981

Ingredient ID: NPC130209

Ingredient ID: NPC126029

Ingredient ID: NPC122768

Ingredient ID: NPC118284

Ingredient ID: NPC116775

Ingredient ID: NPC114239

Ingredient ID: NPC108811

Ingredient ID: NPC108218

Ingredient ID: NPC100980

Ingredient ID: NPC100112