CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Atropa Belladonna

Example Image

PLANiTS DNA barcode

ATCTCGTCGCCCCCGCACGCCTCGCCCGTACTACGGGATGCGGCCGTGTTGCGGGGCGGATACTGGCCTCCCGTGAGCCTTGAGCTCGCGGCTGGCCTAAAAAAGGGTCCACGTCGACGGACGTCGCGGCAATTGGTGGTTGTGAACCAACTCTCATAATGCCGCGGCAGGAGCCCGTCGTGCGTTCGGACTCCCAGACCCTCTCCACGCTAAGGCGCTTCGA

Taxonomic Information

Plant ID: NPO25993
Plant Latin Name: Atropa Belladonna
Taxonomy Genus: Atropa
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 33113
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Romania; Indonesia; India; United States; China; Bulgaria

Traditional Medicine System:

Unani; TCM; Homeopathy; Ayurveda; Siddha

Geographical Distribution

Romania; Indonesia; India; United States; China; Bulgaria

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

74 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

68 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC97820

Ingredient ID: NPC97212

Ingredient ID: NPC84281

Ingredient ID: NPC76336

Ingredient ID: NPC75810

Ingredient ID: NPC69496

Ingredient ID: NPC68926

Ingredient ID: NPC5754

Ingredient ID: NPC55285

Ingredient ID: NPC54511

Ingredient ID: NPC46780

Ingredient ID: NPC46026

Ingredient ID: NPC40684

Ingredient ID: NPC37674

Ingredient ID: NPC35267

Ingredient ID: NPC34647

Ingredient ID: NPC33541

Ingredient ID: NPC327013

Ingredient ID: NPC31563

Ingredient ID: NPC312870

Ingredient ID: NPC309672

Ingredient ID: NPC299603

Ingredient ID: NPC297586

Ingredient ID: NPC295983

Ingredient ID: NPC294909

Ingredient ID: NPC291027

Ingredient ID: NPC28959

Ingredient ID: NPC283790

Ingredient ID: NPC270398

Ingredient ID: NPC267801

Ingredient ID: NPC267466

Ingredient ID: NPC264865

Ingredient ID: NPC255452

Ingredient ID: NPC251298

Ingredient ID: NPC248142

Ingredient ID: NPC247553

Ingredient ID: NPC239189

Ingredient ID: NPC234378

Ingredient ID: NPC233910

Ingredient ID: NPC220860

Ingredient ID: NPC218918

Ingredient ID: NPC211401

Ingredient ID: NPC209773

Ingredient ID: NPC208068

Ingredient ID: NPC204385

Ingredient ID: NPC203445

Ingredient ID: NPC203064

Ingredient ID: NPC200302

Ingredient ID: NPC191830

Ingredient ID: NPC190558

Ingredient ID: NPC189862

Ingredient ID: NPC188152

Ingredient ID: NPC186407

Ingredient ID: NPC181492

Ingredient ID: NPC178263

Ingredient ID: NPC176599

Ingredient ID: NPC172518

Ingredient ID: NPC171551

Ingredient ID: NPC169485

Ingredient ID: NPC164516

Ingredient ID: NPC164378

Ingredient ID: NPC163563

Ingredient ID: NPC151003

Ingredient ID: NPC15039

Ingredient ID: NPC149514

Ingredient ID: NPC13418

Ingredient ID: NPC132923

Ingredient ID: NPC131969

Ingredient ID: NPC117351

Ingredient ID: NPC117056

Ingredient ID: NPC116631

Ingredient ID: NPC109813

Ingredient ID: NPC108939

Ingredient ID: NPC108363

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 2	CYP2D6	Cytochrome P450 2D6	P10635	CHEMBL289
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA2A	Alpha-2a adrenergic receptor	P08913	CHEMBL1867
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA2C	Alpha-2c adrenergic receptor	P18825	CHEMBL1916
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM5	Muscarinic acetylcholine receptor M5	P08912	CHEMBL2035
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM1	Muscarinic acetylcholine receptor M1	P11229	CHEMBL216
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM2	Muscarinic acetylcholine receptor M2	P08172	CHEMBL211
Therapeutic Target	Small molecule receptor (family A GPCR)	CNR2	Cannabinoid CB2 receptor	P34972	CHEMBL253
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM3	Muscarinic acetylcholine receptor M3	P20309	CHEMBL245
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA2B	Alpha-2b adrenergic receptor	P18089	CHEMBL1942
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2
Plant level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01929044	Efficacy of Buscopan® in Comparison With 654-II (Anisodamine) in Acute Gastric or Intestinal Pain	intestinal disease	Anisodamine (NPC69496)	NP level
NCT01150474	Postoperative Belladonna and Morphine Suppositories in Vaginal Surgery	Vaginal Surgery	Atropa Belladonna	Plant level As single plant
NCT02442440	Anisodamine Critically Ill SeptIc Shock	septic shock	Anisodamine (NPC69496)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,ADRA2C,CA9,CHRM3,CHRM2,ADRA2A,DHCR7
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA12,LMNA,CNR2,CA9,ADRA2A,ADRA2C
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,LMNA,CNR2,CA9,ADRA2A,DHCR7
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA9,CHRM3,ADRA2C,CA12,CA9
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CHRM5,KDM4E,ADRA2B,CHRM1,CNR2,ADRA2C
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CHRM3,CHRM2,CHRM1,ADRA2C,CHRM5
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ADRA2C,CHRM5,CNR2,ADRA2A,ADRA2B
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA9,CA12,CHRM1,CHRM5
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	CHRM1,ADRA2C,CNR2,ADRA2B
Peptic ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA61	CHRM1,CHRM5,CHRM3,CHRM2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CHRM1,CA9,ADRA2C
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ADRA2A,CHRM1,CHRM3,CHRM2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,ADRA2C,CA9,ADRA2A
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	LMNA,CNR2,CA9,DHCR7
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CA9,ADRA2A,CYP2D6
Sebaceous gland disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED91	CHRM3,CHRM2,CHRM1
Abnormal micturition Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF50	CHRM5,CHRM2,CHRM1
Functional bladder disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC50	CHRM3,CHRM5,CHRM1
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	CHRM1,CHRM3,CHRM5
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ADRA2A,ADRA2C,ADRA2B
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CHRM3,CHRM5,CHRM2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CHRM1,CA9,DHCR7
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA12,CHRM3,ADRA2C
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,ADRA2B,CA9
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CNR2,CA9,ADRA2C
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CA9,CNR2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,LMNA,CA9
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CHRM1,DHCR7
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,ADRA2C,CNR2
Respiratory system disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB40-CB7Z	CHRM2,CHRM3
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	ADRA2C,CHRM1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	CA9,CA12
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	CHRM5,ADRA2C
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	CHRM5,CHRM3
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CNR2,CYP2D6
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ADRA2C,CHRM1
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	ADRA2A,CNR2
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	CHRM1,CHRM5
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	CHRM1,CHRM5
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CHRM5,CA9
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CA9,CA9
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ADRA2A,LMNA
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9,DHCR7
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ADRA2B,CHRM5
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,ADRA2C
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CYP2D6,CA9
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	ADRA2B,LMNA
Hyperhidrosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EE00	CHRM1
Opioid use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C43	ADRA2A
Oesophagus motility disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA21	CHRM5
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	CHRM1
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	ADRA2C
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	ADRA2A
Pancreatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DC31-DC34	CHRM5
Urgency Disease Category: NA Disease ICD-11 Code: N.A.	CHRM5
Muscle disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB32-FB3Z	CHRM2
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ADRA2C
Epileptic encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A62	CHRM1
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	CNR2
Sjogren syndrome Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A43	CHRM3
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	ADRA2C
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	CHRM5
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	ADRA2C
Dissociative neurological symptom disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B60	ADRA2C
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	CNR2
Corneal disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A76-9A78	CHRM1
Cognition symptoms/signs/clinical sympton Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB21	CHRM5
Central and peripheral nervous disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A04-8E7Z	CHRM5
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CHRM1
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	CHRM1
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	CHRM5
Infectious gastroenteritis/colitis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A40	CHRM5
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	CNR2
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CA9
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	CHRM1
General examination Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QA00	CHRM5
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	CYP2D6
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	ADRA2C
Gastric ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA60	CHRM1
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA12
Appearance/behaviour symptom Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB23	CHRM5
Gastritis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA42	CHRM5
Brain disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70-8E61	CHRM5
Non-specific cutaneous vascular sympton Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME64	ADRA2C
Dystonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A02	CHRM1
Polyuria Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF55	CHRM5
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CHRM1
Nystagmus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C84	CHRM5
Post-traumatic stress disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6B40	ADRA2C
Cough Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD12	CHRM5
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	ADRA2C
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	CHRM3
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	CHRM5
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	CA9
Dyslipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80-5C81	CHRM1
Anterior uveitis Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A96	CHRM5
Abdominal pelvic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD81	CHRM1
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	CHRM1
Diseases of the digestive system, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	NCT01929044
Septic shock Disease Category: X.Extension Codes Disease ICD-11 Code: XS26	NCT02442440
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	ADRA2B
Hypertrophic cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.1	CHRM3
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	CNR2
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	ADRA2A
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CA9
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	CNR2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	ADRA2B

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Atropa Belladonna

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

74 All known Ingredients in Total

68 Ingredients with Acceptable Bioavailablity

19 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of adrenal gland

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Cytomegaloviral disease

Glaucoma

Pain, unspecified

Solid tumour/cancer

General pain disorder

Peptic ulcer

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Adenocarcinoma of pancreas

Adenocarcinoma of bronchus or lung

Sebaceous gland disorder

Abnormal micturition

Functional bladder disorder

Chronic obstructive pulmonary disease

Substance abuse

Asthma

Carcinosarcoma of uterus

Hepatoblastoma

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of thymus

Invasive carcinoma of breast

Glioblastoma of brain

Renal cell carcinoma, chromophobe type

Germ cell tumour of testis

Respiratory system disease

Obesity

Breast cancer

Pulmonary hypertension

Tonus and reflex abnormality

Insomnia

Alzheimer disease

Attention deficit hyperactivity disorder

Irritable bowel syndrome

Parkinsonism

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Other specified malignant neoplasms of kidney, except renal pelvis

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Urothelial carcinoma of bladder

Systemic lupus erythematosus

Malignant neoplasms of thyroid gland, unspecified

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Hyperhidrosis

Opioid use disorder

Oesophagus motility disorder

Dementia

Herpes simplex infection

Depression

Pancreatitis

Urgency

Muscle disorder

Vasomotor/allergic rhinitis

Epileptic encephalopathy

Inborn lipid metabolism error

Sjogren syndrome

Bacterial infection