• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Cirsium Carolinianum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCMCGTCGCCCCAGACCACGCCTYCCCAACGGGGATGCGTTCGTCTGGGGCGGAGAATGGTCTCCCGTGCCGTCGGYGCGGTTGGCCTAAAAAGGAGTCCCCTTCGACGGACGCACGGCTAGTGGTGGTTGTTAAGGCCTTCGTATCGAGCCGTGCGTCGTTAGCCGCAAGGGAAGCGCTCTCTAAAGACCCCAACGTGTCGTCTCGCGACGACGCTTCGACC
Taxonomic Information

Plant ID: NPO25943
Plant Latin Name: Cirsium Carolinianum
Taxonomy Genus: Cirsium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 1308047
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

21 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


13 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9251

Ingredient ID: NPC88645

Ingredient ID: NPC87125

Ingredient ID: NPC85778

Ingredient ID: NPC73468

Ingredient ID: NPC70381

Ingredient ID: NPC47844

Ingredient ID: NPC43669

Ingredient ID: NPC40782

Ingredient ID: NPC279121

Ingredient ID: NPC274881

Ingredient ID: NPC258983

Ingredient ID: NPC243728

Ingredient ID: NPC230301

Ingredient ID: NPC20791

Ingredient ID: NPC171809

Ingredient ID: NPC169749

Ingredient ID: NPC169479

Ingredient ID: NPC126737

Ingredient ID: NPC125062

Ingredient ID: NPC116775