• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Helleborus Niger


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCTCTGCAGAACGACCCGCGAACGTGTAAAACAATATTGTTGTGAGCCGGGAAGGGGTGCGAGCCTCCGACCGGCCCATAAATCGGGTCACTGAACGTCTGCGTCACTCGTGCCTGCTGCCGTGCTTTGCCCCGAACCAACAAAAATCCGGCGCGAATTGCGCCAAGGAAATCTCAACGGAAAAGGGCGCTCTCCCCGTCCGCGGGGAGACGCTTCCAATCCGATACTCGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCTCGATGAAGAACGTAGCGAAATGCCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATACCTTTAGGTTGAGGGCACGTCTGCCTGGGCGTCACACAAAGCGTCGCACCCCACCAATCCCGTTTGGTTAGGAGCGGATATTGGCCCCCCGAACCCCTAGCGGGCACGGTTGGCACAAATATTGGTCTCCGGCGGCGAGCGTCGAAGTCAGCGGTGATTTAAAACACATGTGGACTTGTTGGCCTCGCCGACTGCGCGGCAAAATAACCCTTAGAACCCGTTCTCACGGCGTTCACC

Click for details-----ITS1

NA

Click for details-----ITS2

AAAGCGTCGCACCCCACCAATCCCGTTTGGTTAGGAGCGGATATTGGCCCCCCGAACCCCTAGCGGGCACGGTTGGCACAAATATTGGTCTCCGGCGGCGAGCGTCGAAGTCAGCGGTGATTTAAAACACATGTGGACTTGTTGGCCTCGCCGACTGCGCGGCAAAATAACCCTTAGAACCCGTTCTCACGGCGTTCACC
Taxonomic Information

Plant ID: NPO25809
Plant Latin Name: Helleborus Niger
Taxonomy Genus: Helleborus
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 171896
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Italy; Germany; India; China

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Anthelmintic; Antiemetic; Cardiac; Cathartic; Diuretic; Emetic; Emmenagogue; Homeopathy; Irritant; Miscellany; Narcotic; Parasiticide; Purgative

Geographical Distribution

Germany; Italy; China; India

Geographical Distribution
+
−
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99441

Ingredient ID: NPC89669

Ingredient ID: NPC82920

Ingredient ID: NPC62587

Ingredient ID: NPC300984

Ingredient ID: NPC263185

Ingredient ID: NPC254273

Ingredient ID: NPC230818

Ingredient ID: NPC221792

Ingredient ID: NPC189823

Ingredient ID: NPC179202

Ingredient ID: NPC17025

Ingredient ID: NPC159371

Ingredient ID: NPC158481

Ingredient ID: NPC150817

Ingredient ID: NPC149618

Ingredient ID: NPC117713

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target TypeProtein ClassGene IDProtein NameUniprot IDTarget ChEMBL ID
Drug Transporter SLC superfamily of solute carriers SLCO1B1 Solute carrier organic anion transporter family member 1B1 Q9Y6L6 CHEMBL1697668
Therapeutic Target Protein Phosphatase PTPN1 Protein-tyrosine phosphatase 1B P18031 CHEMBL335
Showing 1 to 2 of 2 entries
Previous1Next
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Clinical trial details
NCT IDTitleConditionForm in clinical useAssociated by plant or compound
No data available in table
Showing 0 to 0 of 0 entries
PreviousNext

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 PTPN1
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 SLCO1B1
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 PTPN1
Adenocarcinoma of prostate
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C82.0
 SLCO1B1
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 SLCO1B1
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 PTPN1
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 PTPN1
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 SLCO1B1
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 PTPN1
Malignant neoplasm metastasis in lymph nodes of head, face or neck
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D60.0
 SLCO1B1
Showing 1 to 10 of 19 entries
Previous12Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group