• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Helleborus Niger


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCTCTGCAGAACGACCCGCGAACGTGTAAAACAATATTGTTGTGAGCCGGGAAGGGGTGCGAGCCTCCGACCGGCCCATAAATCGGGTCACTGAACGTCTGCGTCACTCGTGCCTGCTGCCGTGCTTTGCCCCGAACCAACAAAAATCCGGCGCGAATTGCGCCAAGGAAATCTCAACGGAAAAGGGCGCTCTCCCCGTCCGCGGGGAGACGCTTCCAATCCGATACTCGAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCTCGATGAAGAACGTAGCGAAATGCCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGATACCTTTAGGTTGAGGGCACGTCTGCCTGGGCGTCACACAAAGCGTCGCACCCCACCAATCCCGTTTGGTTAGGAGCGGATATTGGCCCCCCGAACCCCTAGCGGGCACGGTTGGCACAAATATTGGTCTCCGGCGGCGAGCGTCGAAGTCAGCGGTGATTTAAAACACATGTGGACTTGTTGGCCTCGCCGACTGCGCGGCAAAATAACCCTTAGAACCCGTTCTCACGGCGTTCACC

Click for details-----ITS1

NA

Click for details-----ITS2

AAAGCGTCGCACCCCACCAATCCCGTTTGGTTAGGAGCGGATATTGGCCCCCCGAACCCCTAGCGGGCACGGTTGGCACAAATATTGGTCTCCGGCGGCGAGCGTCGAAGTCAGCGGTGATTTAAAACACATGTGGACTTGTTGGCCTCGCCGACTGCGCGGCAAAATAACCCTTAGAACCCGTTCTCACGGCGTTCACC
Taxonomic Information

Plant ID: NPO25809
Plant Latin Name: Helleborus Niger
Taxonomy Genus: Helleborus
Taxonomy Family: Ranunculaceae

Plant External Links:

NCBI TaxonomyDB: 171896
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Italy; Germany; India; China

Traditional Medicine System:
Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Anthelmintic; Antiemetic; Cardiac; Cathartic; Diuretic; Emetic; Emmenagogue; Homeopathy; Irritant; Miscellany; Narcotic; Parasiticide; Purgative

Geographical Distribution

Germany; Italy; China; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

17 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

9 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99441

Ingredient ID: NPC89669

Ingredient ID: NPC82920

Ingredient ID: NPC62587

Ingredient ID: NPC300984

Ingredient ID: NPC263185

Ingredient ID: NPC254273

Ingredient ID: NPC230818

Ingredient ID: NPC221792

Ingredient ID: NPC189823

Ingredient ID: NPC179202

Ingredient ID: NPC17025

Ingredient ID: NPC159371

Ingredient ID: NPC158481

Ingredient ID: NPC150817

Ingredient ID: NPC149618

Ingredient ID: NPC117713