• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Aster Ageratoides


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTGTCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCATGATGGGTTGAGCGTTAGTTCGATCCATGTGGCACACTGTTGATGTGCATCCTTGATGCCCATTTGGGCCTCTTGGTTGTTGCTTCGACATAACAAAATCCCGGCACGGAATGTGCCAAGGAAATTAAAAGTAAAGAATGGCTCGTTCCATGATGTCCCGTTCGCGGTGCGTTCATGGAGCATGGCTTCTTTTTAATCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAACCCATTCGGCTGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCTCCCACCATACCTTCCTTCGGGATGCTAGGTTGGGGGCGGATAATGGCCCCCCGTTCCTCACGGAGTGGTTGGCCAAAATAAAAGTTCCCTTTGATGGATGCACGACTAGTGGTGGTTGACAAAACCCGGTATTGTGTCGTGTGTCTTGTCAAAAGGGTGCAACTTAATAGACCCAACGCGTTGTCATGAAGCAACGCATCGACCGCGA

Click for details-----ITS1

TTGTCGAAGCCTGCAAAGCAGAACGACCCGTGAACATGTTATAACAACCATGCCATGATGGGTTGAGCGTTAGTTCGATCCATGTGGCACACTGTTGATGTGCATCCTTGATGCCCATTTGGGCCTCTTGGTTGTTGCTTCGACATAACAAAATCCCGGCACGGAATGTGCCAAGGAAATTAAAAGTAAAGAATGGCTCGTTCCATGATGTCCCGTTCGCGGTGCGTTCATGGAGCATGGCTTCTTTTTAATCATAAA

Click for details-----ITS2

ATCGCGTCGCTCCCACCATACCTTCCTTCGGGATGCTAGGTTGGGGGCGGATAATGGCCCCCCGTTCCTCACGGAGTGGTTGGCCAAAATAAAAGTTCCCTTTGATGGATGCACGACTAGTGGTGGTTGACAAAACCCGGTATTGTGTCGTGTGTCTTGTCAAAAGGGTGCAACTTAATAGACCCAACGCGTTGTCATGAAGCAACGCATCGACCGCGA
Taxonomic Information

Plant ID: NPO25741
Plant Latin Name: Aster Ageratoides
Taxonomy Genus: Aster
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 714451
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

79 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


18 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

16 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC99574

Ingredient ID: NPC94223

Ingredient ID: NPC93515

Ingredient ID: NPC91416

Ingredient ID: NPC8932

Ingredient ID: NPC84301

Ingredient ID: NPC82770

Ingredient ID: NPC69768

Ingredient ID: NPC68673

Ingredient ID: NPC6674

Ingredient ID: NPC65424

Ingredient ID: NPC63441

Ingredient ID: NPC5473

Ingredient ID: NPC50583

Ingredient ID: NPC49984

Ingredient ID: NPC48800

Ingredient ID: NPC47262

Ingredient ID: NPC44326

Ingredient ID: NPC41750

Ingredient ID: NPC40775

Ingredient ID: NPC40701

Ingredient ID: NPC38714

Ingredient ID: NPC3251

Ingredient ID: NPC306464

Ingredient ID: NPC304477

Ingredient ID: NPC290924

Ingredient ID: NPC286347

Ingredient ID: NPC283849

Ingredient ID: NPC280300

Ingredient ID: NPC277168

Ingredient ID: NPC269108

Ingredient ID: NPC268848

Ingredient ID: NPC268747

Ingredient ID: NPC252334

Ingredient ID: NPC251881

Ingredient ID: NPC250550

Ingredient ID: NPC245712

Ingredient ID: NPC243728

Ingredient ID: NPC242800

Ingredient ID: NPC242611

Ingredient ID: NPC242563

Ingredient ID: NPC241807

Ingredient ID: NPC241631

Ingredient ID: NPC233238

Ingredient ID: NPC229821

Ingredient ID: NPC224757

Ingredient ID: NPC217579

Ingredient ID: NPC208894

Ingredient ID: NPC198991

Ingredient ID: NPC193956

Ingredient ID: NPC188815

Ingredient ID: NPC187808

Ingredient ID: NPC187724

Ingredient ID: NPC186083

Ingredient ID: NPC180579

Ingredient ID: NPC17740

Ingredient ID: NPC175069

Ingredient ID: NPC174537

Ingredient ID: NPC172742

Ingredient ID: NPC168064

Ingredient ID: NPC166709

Ingredient ID: NPC157868

Ingredient ID: NPC153758

Ingredient ID: NPC152044

Ingredient ID: NPC14665

Ingredient ID: NPC142661

Ingredient ID: NPC140707

Ingredient ID: NPC139891

Ingredient ID: NPC139060

Ingredient ID: NPC134810

Ingredient ID: NPC133671

Ingredient ID: NPC122415

Ingredient ID: NPC119501

Ingredient ID: NPC119434

Ingredient ID: NPC116775

Ingredient ID: NPC115162

Ingredient ID: NPC111929

Ingredient ID: NPC10931

Ingredient ID: NPC105751

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Cytochrome P450 Cytochrome P450 family 1 CYP1A1 Cytochrome P450 1A1 P04798 CHEMBL2231
Cytochrome P450 Cytochrome P450 family 1 CYP1A2 Cytochrome P450 1A2 P05177 CHEMBL3356
Cytochrome P450 Cytochrome P450 family 1 CYP1B1 Cytochrome P450 1B1 Q16678 CHEMBL4878
Cytochrome P450 Cytochrome P450 family 2 CYP2A6 Cytochrome P450 2A6 P11509 CHEMBL5282
Therapeutic Target Lyase CA12 Carbonic anhydrase XII O43570 CHEMBL3242
Therapeutic Target Lyase CA2 Carbonic anhydrase II P00918 CHEMBL205
Therapeutic Target Lyase CA7 Carbonic anhydrase VII P43166 CHEMBL2326
Therapeutic Target Lyase CA14 Carbonic anhydrase XIV Q9ULX7 CHEMBL3510
Therapeutic Target Oxidoreductase HSD17B2 Estradiol 17-beta-dehydrogenase 2 P37059 CHEMBL2789
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transcription factor AHR Aryl hydrocarbon receptor P35869 CHEMBL3201
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CA14,CYP2C9,DPP4,HSD17B2,CISD1,CYP1B1,CA2,CA7,LMNA
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 DPP4,HSD17B2,CSNK2A2,TYR,AHR,CA12,CA7,LMNA
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CA12,HSD17B2,CISD1,AHR,CYP1A2,CA2,CSNK2A3
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA14,DPP4,HSD17B2,CISD1,CA2,CA7
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CA12,DPP4,CYP1B1,CA2,CSNK2A3,LMNA
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA14,CYP2C9,DPP4,HSD17B2,AHR,CA12
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 AHR,CA14,CA12,CA2,CSNK2A1
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CA12,CSNK2A2,CISD1,AHR,LMNA
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CYP2C9,DPP4,HSD17B2,CISD1,CYP1B1
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA12,CA2,CA14,CYP2C9
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CA14,CYP2C9,CA2,CYP1A1
Malignant neoplasms of thyroid gland, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D10.Z
 CA12,CA7,CYP1B1,DPP4
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CYP2C9,HSD17B2,CA2,CYP1A1
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CA12,CYP1A2,CA2,CYP1A1
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 CA12,CA7,DPP4,HSD17B2
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA14,CA12,CA2
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 AHR,CYP2A6,DPP4
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CA12,CYP2C9,CA7
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 CA2,DPP4,LMNA
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CA2,CYP2C9,CYP1A2
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CA12,CYP2C9,CA7
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA2,CA12
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 CA2,CA14
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CA12,HSD17B2
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A3,LMNA
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CYP2C9,TYR
Other specified malignant neoplasms ofcolon
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B90.Y
 TYR,CYP1A1
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CA12,CA12
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 CA12,CYP2A6
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 CYP1B1,DPP4
Mycosis fungoides
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B01
 CYP2A6
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 CA2
Acute diabete complication
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A2Y
 DPP4
Malignant haematopoietic neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B33
 DPP4
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 CSNK2A1
Autism spectrum disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A02
 DPP4
Type 2 diabetes mellitus
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A11
 DPP4
Atopic eczema
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA80
 AHR
Chronic arterial occlusive disease
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD4Z
 DPP4
Thrombocytopenia
Disease Category: 03.Diseases of the blood or blood-forming organs
Disease ICD-11 Code: 3B64
 AHR
Acquired hypermelanosis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED60
 TYR
Diabetes mellitus, type unspecified
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A14
 DPP4
Metabolic disorder
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5D2Z
 DPP4
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA2
Myelodysplastic syndrome
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A37
 AHR
Melanoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 TYR
Duodenal ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA63
 CA2
Acquired hypomelanotic disorder
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: ED63
 TYR
Inborn metabolism deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5C59
 CA14
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CA2
Ureteral cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C92
 AHR
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 CA2
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Multiple myeloma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A83
 AHR
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 CA2
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 CA2
Myocardial infarction
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA41-BA43
 DPP4
Coeliac disease
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA95
 CYP1A1
Myelodysplastic syndromes, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A3Z
 CYP2C9
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CA12
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 DPP4
Atrial fibrillation
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BC81.3
 CA7
Myotonic dystrophy
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71.0
 CYP1A1
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 DPP4
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA14
Pneumonia due to Pseudomonasaeruginosa
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA40.05
 DPP4
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CA12
Chronic rhinosinusitis
Disease Category: 12.Diseases of the respiratory system
Disease ICD-11 Code: CA0A
 CYP1A1
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 CYP1A1
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 LMNA
Heart failure, unspecified
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD1Z
 CYP1B1
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 HSD17B2
Gliomas of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.0
 AHR

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group