• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Senna Siamea


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ATCATTGTTGATGCCTCGCAAACAGGACGACTTGCGAACTGGTTGAATTAATCTCGGGGAGGCACACGAGGGGTCCACATTGCCCCGAGTTGCCAGCCCCTTGCCGGGGGCGCAAGAGCGGCCTCGTGCTGCTGCTAGTGTGCCCCGGGCAGCACAACAACTATGGCCCCGGCGCCGGACGCGCCAAGGAACTCGAACAAACGTGCGTAGCCCCGGCGATCCGGATACGGATCCCGCTCGGGGTAAGTCGCGAGAATGGTGTCCAAAATGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGCTGTCCCAAACCCAGACGCCCCTCGAACTGATCGGAGGGGGGGAGGCGCTTGGGCGAAAGTTGGCCTCCCGCGAGCATTGCCTCGCGGATGGTTGAAAAACGAGCCCACGAGTGATGACCGCCACGTTCACGGTGGACGAGCGAAAGCCTCGAGCCCGACCGTGCGCATGATGTCCCTTTGTCTAGGCTGCGAGACCCGTGCAAGCAAGAAAGCGCTCACAACGCGACCCCAG

Click for details-----ITS1

ATCATTGTTGATGCCTCGCAAACAGGACGACTTGCGAACTGGTTGAATTAATCTCGGGGAGGCACACGAGGGGTCCACATTGCCCCGAGTTGCCAGCCCCTTGCCGGGGGCGCAAGAGCGGCCTCGTGCTGCTGCTAGTGTGCCCCGGGCAGCACAACAACTATGGCCCCGGCGCCGGACGCGCCAAGGAACTCGAACAAACGTGCGTAGCCCCGGCGATCCGGATACGGATCCCGCTCGGGGTAAGTCGCGAGAATGGTGTCCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO25715
Plant Latin Name: Senna Siamea
Taxonomy Genus: Senna
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 346999
Plant-of-the-World-Online: 911410-1

Used in Medicines

Country/Region:
Philippines; Indonesia; India; Burkina Faso; Togo; Rwanda; Thailand; Kenya; Nigeria; Tanzania

Traditional Medicine System:
Indian Folk; Siddha

Geographical Distribution

Brazil; Bangladesh; Mauritania; Sudan; Guinea; Nepal; Cambodia; Bahamas; Ethiopia; Rwanda; Tanzania; Swaziland; Laos; Nigeria; Cameroon; Cote d'Ivoire; Ecuador; Benin; Ghana; Australia; Cuba; El Salvador; Venezuela; Zambia; Burkina Faso; Togo; Trinidad and Tobago; Zimbabwe; Thailand; Dominican Republic; United States; Sierra Leone; Liberia; Maldives; Uganda; Philippines; Indonesia; Mauritius; Sri Lanka; Vietnam; Guinea-Bissau; Mali; Malawi; Pakistan; Angola; Myanmar; Chad; South Africa; India; Senegal; Congo; Mozambique; Colombia; Burundi; Kenya; Niger; Fiji

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

240 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


120 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

96 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99587

Ingredient ID: NPC9860

Ingredient ID: NPC95610

Ingredient ID: NPC95062

Ingredient ID: NPC94659

Ingredient ID: NPC92117

Ingredient ID: NPC91955

Ingredient ID: NPC91495

Ingredient ID: NPC87475

Ingredient ID: NPC86655

Ingredient ID: NPC86136

Ingredient ID: NPC85818

Ingredient ID: NPC85571

Ingredient ID: NPC83838

Ingredient ID: NPC83291

Ingredient ID: NPC83189

Ingredient ID: NPC81419

Ingredient ID: NPC75078

Ingredient ID: NPC7447

Ingredient ID: NPC73617

Ingredient ID: NPC73483

Ingredient ID: NPC72675

Ingredient ID: NPC72468

Ingredient ID: NPC7183

Ingredient ID: NPC71195

Ingredient ID: NPC70400

Ingredient ID: NPC69918

Ingredient ID: NPC68324

Ingredient ID: NPC66718

Ingredient ID: NPC65200

Ingredient ID: NPC63100

Ingredient ID: NPC617

Ingredient ID: NPC61341

Ingredient ID: NPC61001

Ingredient ID: NPC59593

Ingredient ID: NPC58877

Ingredient ID: NPC57891

Ingredient ID: NPC57393

Ingredient ID: NPC57380

Ingredient ID: NPC55925

Ingredient ID: NPC55906

Ingredient ID: NPC55098

Ingredient ID: NPC53757

Ingredient ID: NPC51004

Ingredient ID: NPC50315

Ingredient ID: NPC48666

Ingredient ID: NPC485541

Ingredient ID: NPC485540

Ingredient ID: NPC47933

Ingredient ID: NPC479205

Ingredient ID: NPC479204

Ingredient ID: NPC479203

Ingredient ID: NPC478793

Ingredient ID: NPC47826

Ingredient ID: NPC47584

Ingredient ID: NPC47521

Ingredient ID: NPC47234

Ingredient ID: NPC46869

Ingredient ID: NPC46274

Ingredient ID: NPC43918

Ingredient ID: NPC39806

Ingredient ID: NPC38775

Ingredient ID: NPC38771

Ingredient ID: NPC3658

Ingredient ID: NPC35270

Ingredient ID: NPC35022

Ingredient ID: NPC3474

Ingredient ID: NPC3224

Ingredient ID: NPC32109

Ingredient ID: NPC3146

Ingredient ID: NPC311389

Ingredient ID: NPC310581

Ingredient ID: NPC309701

Ingredient ID: NPC309493

Ingredient ID: NPC30869

Ingredient ID: NPC307411

Ingredient ID: NPC306397

Ingredient ID: NPC30560

Ingredient ID: NPC30515

Ingredient ID: NPC301077

Ingredient ID: NPC301058

Ingredient ID: NPC300911

Ingredient ID: NPC300389

Ingredient ID: NPC296589

Ingredient ID: NPC29549

Ingredient ID: NPC29506

Ingredient ID: NPC286137

Ingredient ID: NPC285034

Ingredient ID: NPC284934

Ingredient ID: NPC284752

Ingredient ID: NPC283506

Ingredient ID: NPC283174

Ingredient ID: NPC282818

Ingredient ID: NPC282431

Ingredient ID: NPC280008

Ingredient ID: NPC279943

Ingredient ID: NPC279121

Ingredient ID: NPC27871

Ingredient ID: NPC278127

Ingredient ID: NPC277686

Ingredient ID: NPC276202

Ingredient ID: NPC275048

Ingredient ID: NPC274773

Ingredient ID: NPC273789

Ingredient ID: NPC272844

Ingredient ID: NPC272814

Ingredient ID: NPC271852

Ingredient ID: NPC271482

Ingredient ID: NPC270797

Ingredient ID: NPC267627

Ingredient ID: NPC267403

Ingredient ID: NPC26703

Ingredient ID: NPC266580

Ingredient ID: NPC265705

Ingredient ID: NPC263583

Ingredient ID: NPC261623

Ingredient ID: NPC259866

Ingredient ID: NPC257546

Ingredient ID: NPC256849

Ingredient ID: NPC256766

Ingredient ID: NPC256392

Ingredient ID: NPC254168

Ingredient ID: NPC25389

Ingredient ID: NPC252603

Ingredient ID: NPC25245

Ingredient ID: NPC250436

Ingredient ID: NPC248995

Ingredient ID: NPC24627

Ingredient ID: NPC245827

Ingredient ID: NPC245240

Ingredient ID: NPC24251

Ingredient ID: NPC239943

Ingredient ID: NPC239809

Ingredient ID: NPC238400

Ingredient ID: NPC236208

Ingredient ID: NPC233210

Ingredient ID: NPC232622

Ingredient ID: NPC232364

Ingredient ID: NPC231889

Ingredient ID: NPC230818

Ingredient ID: NPC228715

Ingredient ID: NPC226535

Ingredient ID: NPC225710

Ingredient ID: NPC22451

Ingredient ID: NPC224281

Ingredient ID: NPC222930

Ingredient ID: NPC222183

Ingredient ID: NPC221870

Ingredient ID: NPC221758

Ingredient ID: NPC221231

Ingredient ID: NPC219876

Ingredient ID: NPC219502

Ingredient ID: NPC218796

Ingredient ID: NPC218736

Ingredient ID: NPC215875

Ingredient ID: NPC212031

Ingredient ID: NPC211088

Ingredient ID: NPC209434

Ingredient ID: NPC208886

Ingredient ID: NPC20791

Ingredient ID: NPC20713

Ingredient ID: NPC202868

Ingredient ID: NPC202688

Ingredient ID: NPC202672

Ingredient ID: NPC201814

Ingredient ID: NPC200119

Ingredient ID: NPC195380

Ingredient ID: NPC194977

Ingredient ID: NPC192501

Ingredient ID: NPC191448

Ingredient ID: NPC186628

Ingredient ID: NPC186080

Ingredient ID: NPC184318

Ingredient ID: NPC184102

Ingredient ID: NPC180474

Ingredient ID: NPC18013

Ingredient ID: NPC179746

Ingredient ID: NPC178134

Ingredient ID: NPC176893

Ingredient ID: NPC176740

Ingredient ID: NPC176414

Ingredient ID: NPC174999

Ingredient ID: NPC173602

Ingredient ID: NPC172419

Ingredient ID: NPC171147

Ingredient ID: NPC17039

Ingredient ID: NPC170034

Ingredient ID: NPC169749

Ingredient ID: NPC165382

Ingredient ID: NPC162742

Ingredient ID: NPC161193

Ingredient ID: NPC161066

Ingredient ID: NPC160512

Ingredient ID: NPC157982

Ingredient ID: NPC15669

Ingredient ID: NPC155525

Ingredient ID: NPC153031

Ingredient ID: NPC151709

Ingredient ID: NPC148358

Ingredient ID: NPC142393

Ingredient ID: NPC141810

Ingredient ID: NPC141361

Ingredient ID: NPC14030

Ingredient ID: NPC138118

Ingredient ID: NPC137946

Ingredient ID: NPC137698

Ingredient ID: NPC136859

Ingredient ID: NPC136464

Ingredient ID: NPC135484

Ingredient ID: NPC135222

Ingredient ID: NPC134819

Ingredient ID: NPC133821

Ingredient ID: NPC132250

Ingredient ID: NPC129650

Ingredient ID: NPC128897

Ingredient ID: NPC128792

Ingredient ID: NPC128484

Ingredient ID: NPC125062

Ingredient ID: NPC123316

Ingredient ID: NPC122818

Ingredient ID: NPC12256

Ingredient ID: NPC12172

Ingredient ID: NPC118502

Ingredient ID: NPC117853

Ingredient ID: NPC116850

Ingredient ID: NPC116775

Ingredient ID: NPC115827

Ingredient ID: NPC112065

Ingredient ID: NPC111703

Ingredient ID: NPC111490

Ingredient ID: NPC108776

Ingredient ID: NPC108455

Ingredient ID: NPC107069

Ingredient ID: NPC106770

Ingredient ID: NPC106574

Ingredient ID: NPC106071

Ingredient ID: NPC105591

Ingredient ID: NPC104222

Ingredient ID: NPC103540

Ingredient ID: NPC101035