• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Acorus Calamus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGAACCTGCGGAAGGATCATTGTCGAGGCCCACGGACGAGAACCACCCCAAGAGAACCCGTCATCAACGTCGCCGGGGAGCAGGCCCGGGGCGGAGCCACGCGTGCGCGTGGCGCCCGCCCCCCCTGTTCACCCGGTGCCGCCCCTCCCCGCGCGCGGGGAGGGGAAAACAAAAAACAACCCCGGCGCGGTCTGCGCCAAGGAGCTCTCTTGAGAGGAATGAAAGCGGGCGCGGCGCGTGGCACCGGCCCCTCACCCACCCCGCGGGCTTGCCGGCCACGGCAACTCCCGGGGCGGCTGGGACGGCGGTGCCACCAAGCCCGCGCGGCGCGCATCGAATCATAATGGAAACGATGACTCTCGGCAACGGATATCTAGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGACCCATCGGGTCGAGGGCACGCCTGCCTGGGCGTCACGCCTTCCGTCGCTCCGCGGCACCATCCCCGCCCGATGGCGGGGCTCGTCCCGGATGCGGATGTTGGCCCTCCGTTCCCCCGTGGGCGGTCGGCTGAAACCCAAGGTCCGCTGCGGGTCGCGGCACGGCATGCGGTGGCCTGAGAGGCAGAGTCCCTACCACTCGCGTCGGATGCCTTGCCCGGCCGCGCGTCACAGCGGGCCCGTATGAACCCCACCATCGCCACCGTCCGCAACGGGCC

Click for details-----ITS1

TGAACCTGCGGAAGGATCATTGTCGAGGCCCACGGACGAGAACCACCCCAAGAGAACCCGTCATCAACGTCGCCGGGGAGCAGGCCCGGGGCGGAGCCACGCGTGCGCGTGGCGCCCGCCCCCCCTGTTCACCCGGTGCCGCCCCTCCCCGCGCGCGGGGAGGGGAAAACAAAAAACAACCCCGGCGCGGTCTGCGCCAAGGAGCTCTCTTGAGAGGAATGAAAGCGGGCGCGGCGCGTGGCACCGGCCCCTCACCCACCCCGCGGGCTTGCCGGCCACGGCAACTCCCGGGGCGGCTGGGACGGCGGTGCCACCAAGCCCGCGCGGCGCGCATCGAATCATAATGGAAACGA

Click for details-----ITS2

CTTCCGTCGCTCCGCGGCACCATCCCCGCCCGATGGCGGGGCTCGTCCCGGATGCGGATGTTGGCCCTCCGTTCCCCCGTGGGCGGTCGGCTGAAACCCAAGGTCCGCTGCGGGTCGCGGCACGGCATGCGGTGGCCTGAGAGGCAGAGTCCCTACCACTCGCGTCGGATGCCTTGCCCGGCCGCGCGTCACAGCGGGCCCGTATGAACCCCACCATCGCCACCGTCCGCAACGGGCCGGTGGCGGTCTGGATCGCGAC
Taxonomic Information

Plant ID: NPO25682
Plant Latin Name: Acorus Calamus
Taxonomy Genus: Acorus
Taxonomy Family: Acoraceae

Plant External Links:

NCBI TaxonomyDB: 4465
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Finland; Italy; South Africa; India; Indonesia; Lithuania; China; Greece; Thailand; Bulgaria

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM


Medicinal Functions:

Abortifacient; Anodyne; Antirheumatic; Aphrodisiac; Aromatic; Carminative; Diaphoretic; Emmenagogue; Febrifuge; Hallucinogenic; Homeopathy; Odontalgic; Sedative; Stimulant; Stomachic; Tonic; Vermifuge

Geographical Distribution

Turkey; Indonesia; Italy; South Africa; Lithuania; Finland; India; China; Greece; Thailand; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

233 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


196 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

99 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC99358

Ingredient ID: NPC9880

Ingredient ID: NPC98434

Ingredient ID: NPC95675

Ingredient ID: NPC91574

Ingredient ID: NPC90803

Ingredient ID: NPC90701

Ingredient ID: NPC90506

Ingredient ID: NPC87828

Ingredient ID: NPC8780

Ingredient ID: NPC87384

Ingredient ID: NPC84772

Ingredient ID: NPC82862

Ingredient ID: NPC8011

Ingredient ID: NPC7965

Ingredient ID: NPC79273

Ingredient ID: NPC7927

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC76512

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC7494

Ingredient ID: NPC7491

Ingredient ID: NPC74474

Ingredient ID: NPC74304

Ingredient ID: NPC7343

Ingredient ID: NPC72738

Ingredient ID: NPC71853

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC7057

Ingredient ID: NPC68889

Ingredient ID: NPC68873

Ingredient ID: NPC68052

Ingredient ID: NPC67986

Ingredient ID: NPC67761

Ingredient ID: NPC66577

Ingredient ID: NPC64141

Ingredient ID: NPC61769

Ingredient ID: NPC60548

Ingredient ID: NPC60419

Ingredient ID: NPC57877

Ingredient ID: NPC54264

Ingredient ID: NPC52464

Ingredient ID: NPC52394

Ingredient ID: NPC52230

Ingredient ID: NPC51758

Ingredient ID: NPC51189

Ingredient ID: NPC47844

Ingredient ID: NPC470541

Ingredient ID: NPC46330

Ingredient ID: NPC44751

Ingredient ID: NPC43728

Ingredient ID: NPC43114

Ingredient ID: NPC41385

Ingredient ID: NPC40687

Ingredient ID: NPC40249

Ingredient ID: NPC3857

Ingredient ID: NPC36408

Ingredient ID: NPC35519

Ingredient ID: NPC34902

Ingredient ID: NPC3439

Ingredient ID: NPC32222

Ingredient ID: NPC3155

Ingredient ID: NPC31279

Ingredient ID: NPC311102

Ingredient ID: NPC310905

Ingredient ID: NPC309297

Ingredient ID: NPC307216

Ingredient ID: NPC307011

Ingredient ID: NPC3044

Ingredient ID: NPC304208

Ingredient ID: NPC301043

Ingredient ID: NPC300649

Ingredient ID: NPC300250

Ingredient ID: NPC30025

Ingredient ID: NPC297844

Ingredient ID: NPC297527

Ingredient ID: NPC2951

Ingredient ID: NPC294941

Ingredient ID: NPC294136

Ingredient ID: NPC292792

Ingredient ID: NPC292559

Ingredient ID: NPC292128

Ingredient ID: NPC292092

Ingredient ID: NPC290613

Ingredient ID: NPC290189

Ingredient ID: NPC290078

Ingredient ID: NPC29

Ingredient ID: NPC289540

Ingredient ID: NPC289366

Ingredient ID: NPC287660

Ingredient ID: NPC287335

Ingredient ID: NPC287331

Ingredient ID: NPC286774

Ingredient ID: NPC285734

Ingredient ID: NPC285371

Ingredient ID: NPC279969

Ingredient ID: NPC279404

Ingredient ID: NPC277907

Ingredient ID: NPC277736

Ingredient ID: NPC277693

Ingredient ID: NPC277304

Ingredient ID: NPC277277

Ingredient ID: NPC276005

Ingredient ID: NPC27438

Ingredient ID: NPC273607

Ingredient ID: NPC273295

Ingredient ID: NPC271087

Ingredient ID: NPC269632

Ingredient ID: NPC26906

Ingredient ID: NPC261080

Ingredient ID: NPC259581

Ingredient ID: NPC257124

Ingredient ID: NPC254713

Ingredient ID: NPC253555

Ingredient ID: NPC252539

Ingredient ID: NPC252230

Ingredient ID: NPC249815

Ingredient ID: NPC246543

Ingredient ID: NPC246165

Ingredient ID: NPC244966

Ingredient ID: NPC243671

Ingredient ID: NPC241110

Ingredient ID: NPC240817

Ingredient ID: NPC239998

Ingredient ID: NPC239758

Ingredient ID: NPC239037

Ingredient ID: NPC237010

Ingredient ID: NPC233680

Ingredient ID: NPC231738

Ingredient ID: NPC23145

Ingredient ID: NPC230705

Ingredient ID: NPC230527

Ingredient ID: NPC230301

Ingredient ID: NPC230107

Ingredient ID: NPC229403

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC226709

Ingredient ID: NPC225245

Ingredient ID: NPC22229

Ingredient ID: NPC22030

Ingredient ID: NPC218918

Ingredient ID: NPC216410

Ingredient ID: NPC214909

Ingredient ID: NPC214691

Ingredient ID: NPC214584

Ingredient ID: NPC213842

Ingredient ID: NPC211283

Ingredient ID: NPC210831

Ingredient ID: NPC209279

Ingredient ID: NPC209275

Ingredient ID: NPC208764

Ingredient ID: NPC205643

Ingredient ID: NPC205548

Ingredient ID: NPC204188

Ingredient ID: NPC204120

Ingredient ID: NPC203924

Ingredient ID: NPC200258

Ingredient ID: NPC200129

Ingredient ID: NPC199178

Ingredient ID: NPC196924

Ingredient ID: NPC194586

Ingredient ID: NPC189290

Ingredient ID: NPC189248

Ingredient ID: NPC188238

Ingredient ID: NPC187722

Ingredient ID: NPC187158

Ingredient ID: NPC18449

Ingredient ID: NPC184049

Ingredient ID: NPC180871

Ingredient ID: NPC177112

Ingredient ID: NPC176589

Ingredient ID: NPC173996

Ingredient ID: NPC171665

Ingredient ID: NPC171139

Ingredient ID: NPC166816

Ingredient ID: NPC166362

Ingredient ID: NPC165695

Ingredient ID: NPC16452

Ingredient ID: NPC16157

Ingredient ID: NPC157944

Ingredient ID: NPC157781

Ingredient ID: NPC154792

Ingredient ID: NPC150809

Ingredient ID: NPC14930

Ingredient ID: NPC143639

Ingredient ID: NPC141777

Ingredient ID: NPC1403

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC138347

Ingredient ID: NPC13789

Ingredient ID: NPC13565

Ingredient ID: NPC135238

Ingredient ID: NPC132807

Ingredient ID: NPC132382

Ingredient ID: NPC131981

Ingredient ID: NPC131742

Ingredient ID: NPC127997

Ingredient ID: NPC127993

Ingredient ID: NPC127588

Ingredient ID: NPC126888

Ingredient ID: NPC126240

Ingredient ID: NPC124885

Ingredient ID: NPC124161

Ingredient ID: NPC12269

Ingredient ID: NPC122487

Ingredient ID: NPC121322

Ingredient ID: NPC120926

Ingredient ID: NPC117771

Ingredient ID: NPC115385

Ingredient ID: NPC114764

Ingredient ID: NPC114239

Ingredient ID: NPC113877

Ingredient ID: NPC113278

Ingredient ID: NPC111108

Ingredient ID: NPC110899

Ingredient ID: NPC110639

Ingredient ID: NPC109813

Ingredient ID: NPC108494

Ingredient ID: NPC107482

Ingredient ID: NPC106250

Ingredient ID: NPC105209

Ingredient ID: NPC10455

Ingredient ID: NPC10407

Ingredient ID: NPC102091

Ingredient ID: NPC101285

Ingredient ID: NPC100879

Ingredient ID: NPC100570