• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rumex Japonicus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCTCAGAGCAGACTGACCCGCGAACCCGTTCCTAACACAAACGGCGCCCCCGGGCGCCGCCAACCCACCCCCGGCGCGGATTGCGCCAAGGACCACGAACAAAATCGCCCCCCGGGCGGCCCGGTCCTCCGGAGCCCGCGCGGCGGCGGCGTGTCGTTTCTACCTAACAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGTCTGTCTGGGCGTCACGCACCGCGTCGCCCCCCACCCCCCTCCGGGGGGGCCGGGGGCGGAAACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAAACCCCGCGGCCGCAAAAACGGCCCAACAACTGGTGGCGTACTTCATGGCATCGCGTCGCGCCCTCTACGGCCCCCCGGGAAATCATCGGCCCACCCACTCTACCG

Click for details-----ITS1

NA

Click for details-----ITS2

ACCGCGTCGCCCCCCACCCCCCTCCGGGGGGGCCGGGGGCGGAAACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAAACCCCGCGGCCGCAAAAACGGCCCAACAACTGGTGGCGTACTTCATGGCATCGCGTCGCGCCCTCTACGGCCCCCCGGGAAATCATCGGCCCACCCACTCTACCG
Taxonomic Information

Plant ID: NPO25658
Plant Latin Name: Rumex Japonicus
Taxonomy Genus: Rumex
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 174651
Plant-of-the-World-Online: 697224-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Japan; China; South Africa

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

32 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC70744

Ingredient ID: NPC68873

Ingredient ID: NPC61477

Ingredient ID: NPC32977

Ingredient ID: NPC329148

Ingredient ID: NPC3224

Ingredient ID: NPC312929

Ingredient ID: NPC29883

Ingredient ID: NPC282923

Ingredient ID: NPC280254

Ingredient ID: NPC278525

Ingredient ID: NPC278102

Ingredient ID: NPC267205

Ingredient ID: NPC261619

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC254603

Ingredient ID: NPC233334

Ingredient ID: NPC226855

Ingredient ID: NPC22481

Ingredient ID: NPC223004

Ingredient ID: NPC204932

Ingredient ID: NPC190771

Ingredient ID: NPC176740

Ingredient ID: NPC160499

Ingredient ID: NPC153638

Ingredient ID: NPC1321

Ingredient ID: NPC131221

Ingredient ID: NPC114818

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC105591