CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Rumex Japonicus

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCTCAGAGCAGACTGACCCGCGAACCCGTTCCTAACACAAACGGCGCCCCCGGGCGCCGCCAACCCACCCCCGGCGCGGATTGCGCCAAGGACCACGAACAAAATCGCCCCCCGGGCGGCCCGGTCCTCCGGAGCCCGCGCGGCGGCGGCGTGTCGTTTCTACCTAACAAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGGCCGAGGGCACGTCTGTCTGGGCGTCACGCACCGCGTCGCCCCCCACCCCCCTCCGGGGGGGCCGGGGGCGGAAACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAAACCCCGCGGCCGCAAAAACGGCCCAACAACTGGTGGCGTACTTCATGGCATCGCGTCGCGCCCTCTACGGCCCCCCGGGAAATCATCGGCCCACCCACTCTACCG

Click for details-----ITS1

Click for details-----ITS2

ACCGCGTCGCCCCCCACCCCCCTCCGGGGGGGCCGGGGGCGGAAACTGGCCCCCCGTGCGCCCCGGCGCGCGGCCGGCCTAAACGCAAACCCCGCGGCCGCAAAAACGGCCCAACAACTGGTGGCGTACTTCATGGCATCGCGTCGCGCCCTCTACGGCCCCCCGGGAAATCATCGGCCCACCCACTCTACCG

Taxonomic Information

Plant ID: NPO25658
Plant Latin Name: Rumex Japonicus
Taxonomy Genus: Rumex
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 174651
Plant-of-the-World-Online: 697224-1

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Geographical Distribution

Japan; China; South Africa

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

32 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC70744

Ingredient ID: NPC68873

Ingredient ID: NPC61477

Ingredient ID: NPC32977

Ingredient ID: NPC329148

Ingredient ID: NPC3224

Ingredient ID: NPC312929

Ingredient ID: NPC29883

Ingredient ID: NPC282923

Ingredient ID: NPC280254

Ingredient ID: NPC278525

Ingredient ID: NPC278102

Ingredient ID: NPC267205

Ingredient ID: NPC261619

Ingredient ID: NPC254848

Ingredient ID: NPC254847

Ingredient ID: NPC254603

Ingredient ID: NPC233334

Ingredient ID: NPC226855

Ingredient ID: NPC22481

Ingredient ID: NPC223004

Ingredient ID: NPC204932

Ingredient ID: NPC190771

Ingredient ID: NPC176740

Ingredient ID: NPC160499

Ingredient ID: NPC153638

Ingredient ID: NPC1321

Ingredient ID: NPC131221

Ingredient ID: NPC114818

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC105591

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA6	Carbonic anhydrase VI	P23280	CHEMBL3025
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA1	Carbonic anhydrase I	P00915	CHEMBL261
Therapeutic Target	Lyase	CA14	Carbonic anhydrase XIV	Q9ULX7	CHEMBL3510
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	FYN	Tyrosine-protein kinase FYN	P06241	CHEMBL1841
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Threonine protease	PSMB1	Proteasome component C5	P20618	CHEMBL4208
Therapeutic Target	Unclassified protein	SNCA	Alpha-synuclein	P37840	CHEMBL6152

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	8

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT04386304	Safety and Biomarker Response to (+)-Epicatechin in Becker Muscular Dystrophy	Becker muscular dystrophy	(+)-Epicatechin (NPC261619)	NP level
NCT01118663	Safety and Efficacy Study of a New Formulation of Acetylcysteine Injection	drug-induced liver injury	Acetic Acid (NPC68873)	NP level
NCT01690676	Effect of an Apple Polyphenol Extract on Brachial Artery Flow-mediated Vasodilatory Function	hypertension	(+)-Epicatechin (NPC261619)	NP level
NCT02660112	(+) Epicatechin to Treat Friedreich's Ataxia	Friedreich ataxia	(+)-Epicatechin (NPC261619)	NP level
NCT02330276	Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin	prediabetes syndrome	(+)-Epicatechin (NPC261619)	NP level
NCT02964377	Plus Epicatechin Duchenne Muscular Dystrophy in Non-ambulatory Adolescents	Duchenne muscular dystrophy	(+)-Epicatechin (NPC261619)	NP level
NCT02656212	Early Phase Pre-Clinical and Initial Clinical Research on Epicatechin (Part 2)	prediabetes syndrome	(+)-Epicatechin (NPC261619)	NP level
NCT01705652	Study to Assess the Activity of Nexrutine® in Prostate Cancer Patients	prostate cancer	Rutin (NPC176740)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	ACHE,FYN,SNCA,LMNA,CA2,DRD1,CA14,CA9,CA7
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	ESR1,MTOR,CA12,CA14,CA1,CA6,CA9,CA2
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA12,SNCA,LMNA,DRD1,CA9,TDP1,CSNK2A2,CA7
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CA2,HSD17B10,CA14,CA9,AKR1B1,TDP1,CA7
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	ACHE,PSMB1,HSD17B10,DRD1,CA9,AKR1B1,CA6
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CA12,CA2,ESR1,CA9,CSNK2A1,TDP1
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	CA12,ACHE,SNCA,DRD1,CA14,AKR1B1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,ACHE,CA9,CA6,CA7
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1,CA2,ACHE,CA1
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA12,CA2,CA14,CA6
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA1,CA6,CA2,CA12
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	ACHE,SNCA,CA2,CA14
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,CA9,CSNK2A1,AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	ACHE,CA9,CA1,CA9
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA12,CA9,CA6,CA7
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CA12,CA9,CA12,CA9
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	ACHE,SNCA,LMNA,CA2
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CA1,ACHE,CA14,CA2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CA12,LMNA,CA2,CA9
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CA12,CA9,SNCA,CA7
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ACHE,AKR1B1,MTOR
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	DRD1,MTOR NCT01690676
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	ESR1,MTOR NCT01705652
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA1,AKR1B1,CA2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	DRD1,ACHE,SNCA
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CA1,AKR1B1,CA12
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA9,AKR1B1,CA2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	CA9,CA6,CA2
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	CA12,CA9,ESR1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	SNCA,ACHE
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	DRD1,AKR1B1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	CA9,MTOR
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	CA2,ESR1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	MTOR,FYN
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE,DRD1
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2,CA1
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	MTOR,CSNK2A1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	MTOR,CA9
Intermediate hyperglycaemia, unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.Z	NCT02330276,NCT02656212
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	DRD1,CA6
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CA9,CA6
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,CA9
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	CA12,CA7
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA12,CA2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FYN,ESR1
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	CA9,CA2,CA1,CA6,CSNK2A1,CA12,MTOR,CA14,ESR1,FYN
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	CA12,ACHE,PSMB1,LMNA,HSD17B10,CA9,CSNK2A1,AKR1B1,TDP1,CSNK2A2
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FYN
Metastatic tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E2Z	ESR1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR1
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	MTOR
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD1
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	ESR1
Inborn metabolism deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5C59	CA14
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	MTOR
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	MTOR
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Pleural mesothelioma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26	MTOR
Female genital tract noninflammatory disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA1Y	ESR1
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	ESR1
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR1
Lymphangioleiomyomatosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB07	MTOR
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	MTOR
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2
Breast in situ carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65	ESR1
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	ACHE
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Menstrual cycle bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20	ESR1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	ESR1
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	MTOR
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	MTOR
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	ESR1
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	ESR1
Autonomic nervous system disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D87	SNCA
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1
Skeletal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD24	ESR1
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Female infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA31	ESR1
Vaginitis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA02	ESR1
Arteries/arterioles disorder Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD52	MTOR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	MTOR
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	ESR1
Hydrocephalus Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8D64	MTOR
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MTOR
Dyspareunia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA12	ESR1
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	MTOR
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	ESR1
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	MTOR
Male infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB04	ESR1
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	MTOR
Duchenne muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.1	NCT02964377
Drug-induced or toxic liver disease, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB95.Z	NCT01118663
Becker muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70.0	NCT04386304
Friedreich ataxia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A03.10	NCT02660112
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	ACHE
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CA12
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B1
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CA9
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CA6
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	ACHE
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA1
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	CA14
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ACHE
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CA9
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	CA1
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	ACHE
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	CA1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Rumex Japonicus

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

32 All known Ingredients in Total

28 Ingredients with Acceptable Bioavailablity

26 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Breast cancer

Mesothelioma of pleura

Carcinosarcoma of uterus

Malignant neoplasms of thymus

Serous cystadenoma,borderline malignancy of ovary

Germ cell tumour of testis

Adenocarcinoma of bronchus or lung

Glaucoma

Bacterial infection

Seborrhoeic dermatitis

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Hepatocellular carcinoma of liver

Superficial ovarian endometriosis

Cytomegaloviral disease

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Pain, unspecified

Pulmonary hypertension

Prostate cancer

Rheumatoid arthritis

Parkinsonism

Hepatoblastoma

Urothelial carcinoma of bladder

Malignant neoplasms of corpus uteri, unspecified

Invasive carcinoma of breast

Alzheimer disease

Schizophrenia

Mature T-cell lymphoma

Low bone mass disorder

Multiple myeloma

Dementia

Duodenal ulcer

Liver cancer

Renal cell carcinoma

Intermediate hyperglycaemia, unspecified

Adenocarcinoma of stomach

Other specified malignant neoplasms ofcolon

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of thyroid gland, unspecified

Renal cell carcinoma, chromophobe type

Carpal tunnel syndrome

Solid tumour/cancer

Diffuse large B-cell lymphomas

Myeloproliferative neoplasm

Metastatic tumour

Insomnia

Menopausal disorder

Essential hypertension

Metastatic lymph node neoplasm

Allergic/hypersensitivity disorder

Pituitary gland disorder

Inborn metabolism deficiency

Malignant mesenchymal neoplasm

Transplant rejection

Unspecific substance harmful effect

Pleural mesothelioma

Female genital tract noninflammatory disorder

Myasthenia gravis