• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Smilax China


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

CCCGTCCCTCCGGCCCGTCGCCCCTCGGGCCGCGGCCGCACGGCCCGACCCGGCGTGCGGAGGACACAACCCGGCGCGGCGCGCGCCAAGGAACGACCGTCGGAACAGGGCTCCGCCCCCGCCCGCGCGGCGGGGCGGCGCCTCGCTCTACTTGAAACTGTA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO25611
Plant Latin Name: Smilax China
Taxonomy Genus: Smilax
Taxonomy Family: Smilacaceae

Plant External Links:

NCBI TaxonomyDB: 49657
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Philippines; Indonesia; India; Malaysia; Vietnam; China; South Korea

Traditional Medicine System:
TCM; Unani; Ayurveda; Siddha


Medicinal Functions:

Alterative; Antipsoriatic; Antiscrophulatic; Carminative; Depurative; Diaphoretic; Diuretic; Skin; Tonic; VD

Geographical Distribution

Philippines; Indonesia; India; Malaysia; Vietnam; China; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

101 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


37 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

69 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC92565

Ingredient ID: NPC89904

Ingredient ID: NPC87898

Ingredient ID: NPC79943

Ingredient ID: NPC7543

Ingredient ID: NPC72722

Ingredient ID: NPC70744

Ingredient ID: NPC70616

Ingredient ID: NPC70314

Ingredient ID: NPC68873

Ingredient ID: NPC62290

Ingredient ID: NPC61506

Ingredient ID: NPC61477

Ingredient ID: NPC61

Ingredient ID: NPC60523

Ingredient ID: NPC52382

Ingredient ID: NPC52197

Ingredient ID: NPC47844

Ingredient ID: NPC46190

Ingredient ID: NPC36835

Ingredient ID: NPC36288

Ingredient ID: NPC34864

Ingredient ID: NPC3460

Ingredient ID: NPC32643

Ingredient ID: NPC32441

Ingredient ID: NPC315084

Ingredient ID: NPC311485

Ingredient ID: NPC303422

Ingredient ID: NPC302857

Ingredient ID: NPC294902

Ingredient ID: NPC292461

Ingredient ID: NPC292452

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC287615

Ingredient ID: NPC28651

Ingredient ID: NPC275255

Ingredient ID: NPC273603

Ingredient ID: NPC27144

Ingredient ID: NPC270578

Ingredient ID: NPC267649

Ingredient ID: NPC262911

Ingredient ID: NPC262182

Ingredient ID: NPC261619

Ingredient ID: NPC260491

Ingredient ID: NPC257653

Ingredient ID: NPC254963

Ingredient ID: NPC248573

Ingredient ID: NPC246162

Ingredient ID: NPC243728

Ingredient ID: NPC242419

Ingredient ID: NPC240476

Ingredient ID: NPC236709

Ingredient ID: NPC233443

Ingredient ID: NPC230726

Ingredient ID: NPC230301

Ingredient ID: NPC222910

Ingredient ID: NPC219876

Ingredient ID: NPC216819

Ingredient ID: NPC216630

Ingredient ID: NPC215095

Ingredient ID: NPC21301

Ingredient ID: NPC212797

Ingredient ID: NPC20791

Ingredient ID: NPC201148

Ingredient ID: NPC187154

Ingredient ID: NPC181153

Ingredient ID: NPC18074

Ingredient ID: NPC177941

Ingredient ID: NPC177100

Ingredient ID: NPC176740

Ingredient ID: NPC174744

Ingredient ID: NPC173637

Ingredient ID: NPC173203

Ingredient ID: NPC167976

Ingredient ID: NPC166456

Ingredient ID: NPC163508

Ingredient ID: NPC162261

Ingredient ID: NPC161571

Ingredient ID: NPC15970

Ingredient ID: NPC158823

Ingredient ID: NPC157338

Ingredient ID: NPC156654

Ingredient ID: NPC15658

Ingredient ID: NPC153342

Ingredient ID: NPC150560

Ingredient ID: NPC149209

Ingredient ID: NPC143011

Ingredient ID: NPC142731

Ingredient ID: NPC142591

Ingredient ID: NPC139540

Ingredient ID: NPC126200

Ingredient ID: NPC126029

Ingredient ID: NPC116775

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC110110

Ingredient ID: NPC1075

Ingredient ID: NPC104195

Ingredient ID: NPC101098

Ingredient ID: NPC100400