• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Beta Vulgaris


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

GGTGAACCTGCGGAAGGATCATTGTCGAATCTGCAAAGCAGAGCAACCAGCGAACATGTTTTACATCTGTGGGAAGGGGGTGCTGGCACGATGCTTTGGGTTGTGCCAGCCCCTCCCCCATGTCGCGGGGCACTCCTACTTGGTGTGCTCCCCGGCGAAAAAAACAAACCACGGCGCTTACTGCGCCAAGGAACATGAAAAGGAGTGTGCCTGTCCTATGCATCGGTTTGCCGGTGCGGGGATGTGGCACCCAGTATTAAGAGATAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO25583
Plant Latin Name: Beta Vulgaris
Taxonomy Genus: Beta
Taxonomy Family: Chenopodiaceae

Plant External Links:

NCBI TaxonomyDB: 161934
Plant-of-the-World-Online: 164505-1

Used in Medicines

Country/Region:
Turkey; Italy; India; United States; Jordan; China; South Korea; Spain

Traditional Medicine System:
Unani; TCM; Homeopathy; Ayurveda

Geographical Distribution

Turkey; Italy; Bangladesh; Sudan; France; Ethiopia; Ireland; Argentina; Cameroon; Saudi Arabia; Iran; Algeria; Cuba; Norway; Jordan; China; Chile; Belgium; Germany; Dominican Republic; Iraq; Spain; Eritrea; Netherlands; Libya; Denmark; Finland; United States; Morocco; Sweden; New Zealand; Russia; Bulgaria; Pakistan; Albania; Honduras; Portugal; Mexico; Egypt; South Africa; India; United Kingdom; Tunisia; Greece; South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

164 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


114 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

97 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99068

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC93342

Ingredient ID: NPC85813

Ingredient ID: NPC85561

Ingredient ID: NPC81010

Ingredient ID: NPC7973

Ingredient ID: NPC79321

Ingredient ID: NPC78312

Ingredient ID: NPC78302

Ingredient ID: NPC7466

Ingredient ID: NPC74580

Ingredient ID: NPC70744

Ingredient ID: NPC70036

Ingredient ID: NPC67195

Ingredient ID: NPC66700

Ingredient ID: NPC65435

Ingredient ID: NPC62045

Ingredient ID: NPC59650

Ingredient ID: NPC55900

Ingredient ID: NPC55412

Ingredient ID: NPC49448

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490332

Ingredient ID: NPC489907

Ingredient ID: NPC480596

Ingredient ID: NPC480595

Ingredient ID: NPC480594

Ingredient ID: NPC4481

Ingredient ID: NPC43412

Ingredient ID: NPC42544

Ingredient ID: NPC424

Ingredient ID: NPC3780

Ingredient ID: NPC34908

Ingredient ID: NPC34770

Ingredient ID: NPC3343

Ingredient ID: NPC328447

Ingredient ID: NPC322254

Ingredient ID: NPC317120

Ingredient ID: NPC313851

Ingredient ID: NPC312617

Ingredient ID: NPC310934

Ingredient ID: NPC309330

Ingredient ID: NPC307729

Ingredient ID: NPC302933

Ingredient ID: NPC300059

Ingredient ID: NPC299565

Ingredient ID: NPC29883

Ingredient ID: NPC29841

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC293628

Ingredient ID: NPC293539

Ingredient ID: NPC292902

Ingredient ID: NPC291473

Ingredient ID: NPC288669

Ingredient ID: NPC287979

Ingredient ID: NPC287865

Ingredient ID: NPC286347

Ingredient ID: NPC286342

Ingredient ID: NPC286170

Ingredient ID: NPC281686

Ingredient ID: NPC281131

Ingredient ID: NPC279865

Ingredient ID: NPC279661

Ingredient ID: NPC279121

Ingredient ID: NPC27836

Ingredient ID: NPC272614

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC26596

Ingredient ID: NPC265305

Ingredient ID: NPC26496

Ingredient ID: NPC262756

Ingredient ID: NPC261831

Ingredient ID: NPC261195

Ingredient ID: NPC25495

Ingredient ID: NPC253634

Ingredient ID: NPC245346

Ingredient ID: NPC242580

Ingredient ID: NPC238192

Ingredient ID: NPC237812

Ingredient ID: NPC235215

Ingredient ID: NPC229235

Ingredient ID: NPC226453

Ingredient ID: NPC225710

Ingredient ID: NPC22472

Ingredient ID: NPC22449

Ingredient ID: NPC222750

Ingredient ID: NPC221388

Ingredient ID: NPC220765

Ingredient ID: NPC219737

Ingredient ID: NPC214138

Ingredient ID: NPC209846

Ingredient ID: NPC208793

Ingredient ID: NPC208683

Ingredient ID: NPC20791

Ingredient ID: NPC207691

Ingredient ID: NPC204854

Ingredient ID: NPC203468

Ingredient ID: NPC203050

Ingredient ID: NPC202056

Ingredient ID: NPC197499

Ingredient ID: NPC197087

Ingredient ID: NPC19687

Ingredient ID: NPC196561

Ingredient ID: NPC195046

Ingredient ID: NPC193989

Ingredient ID: NPC193154

Ingredient ID: NPC191459

Ingredient ID: NPC190322

Ingredient ID: NPC189958

Ingredient ID: NPC189436

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC185170

Ingredient ID: NPC17810

Ingredient ID: NPC176665

Ingredient ID: NPC174246

Ingredient ID: NPC171495

Ingredient ID: NPC169749

Ingredient ID: NPC168718

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC166778

Ingredient ID: NPC163524

Ingredient ID: NPC161593

Ingredient ID: NPC155156

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC147983

Ingredient ID: NPC146422

Ingredient ID: NPC142771

Ingredient ID: NPC142415

Ingredient ID: NPC137958

Ingredient ID: NPC137915

Ingredient ID: NPC136014

Ingredient ID: NPC135585

Ingredient ID: NPC135539

Ingredient ID: NPC133183

Ingredient ID: NPC130894

Ingredient ID: NPC130683

Ingredient ID: NPC126681

Ingredient ID: NPC125575

Ingredient ID: NPC123557

Ingredient ID: NPC118429

Ingredient ID: NPC117418

Ingredient ID: NPC116775

Ingredient ID: NPC1157

Ingredient ID: NPC115245

Ingredient ID: NPC11433

Ingredient ID: NPC114132

Ingredient ID: NPC112890

Ingredient ID: NPC112866

Ingredient ID: NPC111897

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC109851

Ingredient ID: NPC10980

Ingredient ID: NPC108100

Ingredient ID: NPC105242

Ingredient ID: NPC103347