CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Buchenavia Tetraphylla

Example Image

PLANiTS DNA barcode

ATCGTTCAGCCTCCAAAACCTTCGCCCCTCGAAAGCCGGGGCGATGGTCCGGATGCGGAAGCTGGCCTCCCGCGACCGCGTGCCGCGGATGGCCCAAACACGTGCTGGGGAAGCGAAGCGCCACGGCATTCGGTGGTCGATCCAAAGCCCCACGAGCAGTGCCGGCGGCGGCCGCATCCGTCCTCAGCCCGCGACCCTAAACGCTAACCGACG

Taxonomic Information

Plant ID: NPO25550
Plant Latin Name: Buchenavia Tetraphylla
Taxonomy Genus: Buchenavia
Taxonomy Family: Combretaceae

Plant External Links:

NCBI TaxonomyDB: 470568
Plant-of-the-World-Online: 912166-1

Used in Medicines

Unknown.

Geographical Distribution

Brazil; Suriname; Cuba; Trinidad and Tobago; French Guiana; Colombia; Dominican Republic; Bolivia; Venezuela; Haiti

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

115 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

88 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

44 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC96613

Ingredient ID: NPC90232

Ingredient ID: NPC85813

Ingredient ID: NPC84771

Ingredient ID: NPC83702

Ingredient ID: NPC77249

Ingredient ID: NPC76314

Ingredient ID: NPC71394

Ingredient ID: NPC69871

Ingredient ID: NPC68267

Ingredient ID: NPC57801

Ingredient ID: NPC56448

Ingredient ID: NPC4465

Ingredient ID: NPC43520

Ingredient ID: NPC43360

Ingredient ID: NPC37132

Ingredient ID: NPC3707

Ingredient ID: NPC34903

Ingredient ID: NPC307945

Ingredient ID: NPC3016

Ingredient ID: NPC301585

Ingredient ID: NPC299505

Ingredient ID: NPC298802

Ingredient ID: NPC297117

Ingredient ID: NPC29678

Ingredient ID: NPC294548

Ingredient ID: NPC293249

Ingredient ID: NPC292825

Ingredient ID: NPC28657

Ingredient ID: NPC286052

Ingredient ID: NPC283011

Ingredient ID: NPC279974

Ingredient ID: NPC274729

Ingredient ID: NPC27407

Ingredient ID: NPC27349

Ingredient ID: NPC27243

Ingredient ID: NPC26974

Ingredient ID: NPC267741

Ingredient ID: NPC266359

Ingredient ID: NPC264833

Ingredient ID: NPC263785

Ingredient ID: NPC26229

Ingredient ID: NPC261831

Ingredient ID: NPC260691

Ingredient ID: NPC258220

Ingredient ID: NPC257383

Ingredient ID: NPC255647

Ingredient ID: NPC249578

Ingredient ID: NPC249194

Ingredient ID: NPC247835

Ingredient ID: NPC243728

Ingredient ID: NPC23925

Ingredient ID: NPC238041

Ingredient ID: NPC23795

Ingredient ID: NPC233481

Ingredient ID: NPC230923

Ingredient ID: NPC23046

Ingredient ID: NPC230301

Ingredient ID: NPC229216

Ingredient ID: NPC228906

Ingredient ID: NPC22260

Ingredient ID: NPC222147

Ingredient ID: NPC220759

Ingredient ID: NPC219560

Ingredient ID: NPC217914

Ingredient ID: NPC216630

Ingredient ID: NPC216187

Ingredient ID: NPC216127

Ingredient ID: NPC2114

Ingredient ID: NPC209970

Ingredient ID: NPC207632

Ingredient ID: NPC202651

Ingredient ID: NPC201950

Ingredient ID: NPC201844

Ingredient ID: NPC199773

Ingredient ID: NPC196924

Ingredient ID: NPC196370

Ingredient ID: NPC196227

Ingredient ID: NPC19404

Ingredient ID: NPC189092

Ingredient ID: NPC187445

Ingredient ID: NPC179798

Ingredient ID: NPC17599

Ingredient ID: NPC168030

Ingredient ID: NPC163755

Ingredient ID: NPC162742

Ingredient ID: NPC158963

Ingredient ID: NPC155461

Ingredient ID: NPC154186

Ingredient ID: NPC153958

Ingredient ID: NPC151250

Ingredient ID: NPC149184

Ingredient ID: NPC148403

Ingredient ID: NPC145444

Ingredient ID: NPC145277

Ingredient ID: NPC143008

Ingredient ID: NPC142349

Ingredient ID: NPC142027

Ingredient ID: NPC139473

Ingredient ID: NPC138222

Ingredient ID: NPC136932

Ingredient ID: NPC126750

Ingredient ID: NPC126503

Ingredient ID: NPC123965

Ingredient ID: NPC120151

Ingredient ID: NPC119802

Ingredient ID: NPC119036

Ingredient ID: NPC116726

Ingredient ID: NPC113733

Ingredient ID: NPC107860

Ingredient ID: NPC107629

Ingredient ID: NPC106770

Ingredient ID: NPC105354

Ingredient ID: NPC105267

Ingredient ID: NPC104050

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	AKR1C3	Aldo-keto-reductase family 1 member C3	P42330	CHEMBL4681
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083
Therapeutic Target	Fatty acid binding protein family	FABP5	Fatty acid binding protein epidermal	Q01469	CHEMBL3674
Therapeutic Target	Nuclear hormone receptor subfamily 1	PPARA	Peroxisome proliferator-activated receptor alpha	Q07869	CHEMBL239
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Oxidoreductase	PTGS2	Cyclooxygenase-2	P35354	CHEMBL230
Therapeutic Target	Oxidoreductase	ALOX15	Arachidonate 15-lipoxygenase	P16050	CHEMBL2903
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR1	Free fatty acid receptor 1	O14842	CHEMBL4422
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR4	G-protein coupled receptor 120	Q5NUL3	CHEMBL5339
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	13

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00029679	Borage Oil and Ginkgo Biloba (EGb 761) in Asthma	asthma	Linoleic Acid (NPC85813)	NP level
NCT00204932	Effects of CLA Supplements on Body Weight and Fat Oxidation	obesity	Linoleic Acid (NPC85813)	NP level
NCT00908791	Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue	breast cancer	Linoleic Acid (NPC85813)	NP level
NCT00965068	Cholesterol in ASD: Characterization and Treatment	Asperger syndrome;autism	Cholesterol (NPC28657)	NP level
NCT00638196	Placebo vs. Linoleic Acid Controlled Assessment of Treatment Efficacy in MS	multiple sclerosis	Oleic Acid (NPC261831)	NP level
NCT00951158	A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors	neoplasm	Linoleic Acid (NPC85813)	NP level
NCT00272844	Treatment of the Cholesterol Defect in Smith-Lemli-Opitz Syndrome	Smith-Lemli-Opitz syndrome	Cholesterol (NPC28657)	NP level
NCT02063802	Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children	obesity	Linoleic Acid (NPC85813)	NP level
NCT01661764	Fish Oil Supplementation, Nutrigenomics and Colorectal Cancer Prevention	colorectal adenoma	Oleic Acid (NPC261831)	NP level
NCT00009841	Gene Therapy in Treating Patients With Advanced Head and Neck Cancer	head and neck malignant neoplasia	Cholesterol (NPC28657)	NP level
NCT04359823	DSAP Treatment Comparison	porokeratosis	Cholesterol (NPC28657)	NP level
NCT00607945	Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus	type 2 diabetes mellitus	Linoleic Acid (NPC85813)	NP level
NCT01792310	A Phase 1/2A Study of LAM561 in Adult Patients With Advanced Solid Tumours	glioma	Oleic Acid (NPC261831)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	NR1I2,PPARA,LMNA,TSHR,OR51E2,FABP4,FABP5,FABP3,FFAR1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	NR1I2,LMNA,AKR1C3,OR51E2,F2,ALOX15,FFAR4,FABP3,PTGS2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	NR1I2,TSHR,PTGS2,RORC,FABP5,ALOX15,FFAR4,FFAR1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	NR1I2,TSHR,RORC,FABP5,ALOX15,FFAR4,FABP3
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	FFAR4,FABP5,TSHR,OR51E2,F2,FABP5,FFAR4
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2,FFAR1,PPARA,PTGS2 NCT00607945
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	LMNA,OR51E2,ALOX15,FFAR4,FFAR1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1C3,OR51E2,FABP4,FABP5,AKR1C3
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	FABP5,FABP3,OR51E2,FABP4
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AKR1C3,F2,FABP4,PTGS2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	TSHR,AKR1C3,OR51E2,F2
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	NR1I2,TSHR,AKR1C3,F2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA,TSHR,PTGS2,FABP5
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	FABP5,FABP3,OR51E2,FFAR1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RORC,F2 NCT00638196
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2,PTGS2 NCT00029679
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	PPARA,F2,PTGS2
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	RORC,PTGS2,PPARA
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	FABP5,RORC,OR51E2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,OR51E2,FABP5
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NR1I2,FABP3,FFAR1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	FABP3,LMNA,PTGS2
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	ALOX15,OR51E2,FABP5
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FABP5,ALOX15,FFAR4
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	F2,FABP5,FABP3
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PPARA,FFAR1
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	PPARA FABP4
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC PTGS2
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	PTGS2,AKR1C3
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	PTGS2,F2
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PTGS2,PPARA
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RORC FABP5
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	NCT00204932,NCT02063802
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	ALOX15,F2
Malignant neoplasms of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	PTGS2,FABP4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	RORC,F2
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	F2,ALOX15
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,FFAR1
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	PTGS2,FFAR1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	FFAR4,OR51E2
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FFAR1
Inflammatory spondyloarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA92	PTGS2
HIV-infected patients with tuberculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1B10-1B14	PTGS2
Spinal pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME84	PTGS2
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	TSHR
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AKR1C3
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	PTGS2
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	PTGS2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PTGS2
Reactive arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA11	PTGS2
Joint pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME82	PTGS2
Dyslipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80-5C81	PPARA
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	PTGS2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	PTGS2
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	PTGS2
Inborn lipid metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52	PPARA
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	PPARA
Knee osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	PTGS2
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	PPARA
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	PTGS2
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTGS2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	RORC
Hyperlipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PPARA
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	PTGS2
Otitis media Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA80-AB0Z	PTGS2
Inherited coagulation factor deficiency Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B14	PTGS2
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	PTGS2
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	PTGS2
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	PTGS2
Urinary system disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC2Z	PTGS2
Hypo-thyroidism Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A00	TSHR
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	NCT01661764
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	NCT00009841
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	NCT00965068
Autism spectrum disorder without disorder of intellectual development and with mild or no impairment of functional language Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02.0	NCT00965068
Porokeratoses Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED52	NCT04359823
Glioma, malignant Disease Category: X.Extension Codes Disease ICD-11 Code: XH4RQ3	NCT01792310
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT00951158
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NCT00908791
Disorders of cholesterol synthesis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52.10	NCT00272844
Non-alcoholic steatohepatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92.1	PTGS2
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	TSHR
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	TSHR
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	NR1I2
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	TSHR
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	PTGS2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	F2
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1C3
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ALOX15
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ALOX15
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	FABP4
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	FFAR1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	FFAR1
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	FABP4
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FFAR4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	PTGS2
Malignant neoplasm of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	FABP4
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1C3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Buchenavia Tetraphylla

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

115 All known Ingredients in Total

88 Ingredients with Acceptable Bioavailablity

44 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Carcinosarcoma of uterus

Serous cystadenoma,borderline malignancy of ovary

Other specified malignant neoplasms of kidney, except renal pelvis

Type 2 diabetes mellitus

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Hepatoblastoma

Malignant neoplasm metastasis in lymph nodes of head, face or neck

Squamous cell carcinoma of bronchus or lung

Adenocarcinoma of bronchus or lung

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Multiple sclerosis

Asthma

Cardiovascular disease

Solid tumour/cancer

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Melanoma of skin

Superficial ovarian endometriosis

Adenocarcinoma of prostate

Malignant neoplasms of thymus

Germ cell tumour of testis

Acute diabete complication

Non-alcoholic fatty liver disease

Crohn disease

Female pelvic pain

Myocardial infarction

Hyper-lipoproteinaemia

Psoriasis

Obesity

Adenocarcinoma of stomach

Malignant neoplasms of bladder

Tetralogy of Fallot

Malignant neoplasms of corpus uteri, unspecified

Chikungunya virus disease

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Carpal tunnel syndrome

Idiopathic interstitial pneumonitis

Inflammatory spondyloarthritis

HIV-infected patients with tuberculosis

Spinal pain

Thyroid cancer

Nutritional deficiency

Prostate cancer

Cerebral ischaemic stroke

Rheumatoid arthritis

Osteoarthritis

Alzheimer disease

Reactive arthropathy

Joint pain

Dyslipidemia

Endometriosis

Pain, unspecified

Coronary thrombosis

Coagulation defect

Thrombocytopenia

Cerebral ischaemia

Inborn lipid metabolism error

Gout

Knee osteoarthritis

Diabetes mellitus, type unspecified