• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Senegalia Pennata


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

AGCGTCGCCCCGCCCCCCTCCGCGGGCGCGGGACGGATGTTGGCCTCCCGGGGGCCTCGCCCCCCGGCCGGCCGAAAAAGGGGCCCGGCGTGACGGACGCCACGATCCACGGTGGTTGAGCGGGCGCCCCGCTCGAGGCCAAGACGTGAGCGGGCCGTCCCACGGCGAGGGCCCGTCCCCCCACCCGAACGCGACCCCAGGTCAGGCGGGG
Taxonomic Information

Plant ID: NPO25538
Plant Latin Name: Senegalia Pennata
Taxonomy Genus: Senegalia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1341699
Plant-of-the-World-Online: 77125575-1

Used in Medicines

Country/Region:
Ghana; India; Burkina Faso; Laos

Traditional Medicine System:
Indian Folk; Ayurveda; Siddha

Geographical Distribution

Bangladesh; Mauritania; Guinea; Nepal; Laos; Nigeria; Cameroon; Cote d'Ivoire; Benin; Ghana; Australia; Burkina Faso; Togo; China; Thailand; Sierra Leone; Liberia; Mali; Seychelles; Myanmar; India; Senegal; Congo; Sri Lanka

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

19 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


3 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC82696

Ingredient ID: NPC73865

Ingredient ID: NPC47521

Ingredient ID: NPC290289

Ingredient ID: NPC287956

Ingredient ID: NPC281774

Ingredient ID: NPC26536

Ingredient ID: NPC255906

Ingredient ID: NPC240429

Ingredient ID: NPC219876

Ingredient ID: NPC212938

Ingredient ID: NPC200684

Ingredient ID: NPC190204

Ingredient ID: NPC188535

Ingredient ID: NPC184536

Ingredient ID: NPC178134

Ingredient ID: NPC177759

Ingredient ID: NPC165967

Ingredient ID: NPC109878