CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Senegalia Pennata

Example Image

PLANiTS DNA barcode

AGCGTCGCCCCGCCCCCCTCCGCGGGCGCGGGACGGATGTTGGCCTCCCGGGGGCCTCGCCCCCCGGCCGGCCGAAAAAGGGGCCCGGCGTGACGGACGCCACGATCCACGGTGGTTGAGCGGGCGCCCCGCTCGAGGCCAAGACGTGAGCGGGCCGTCCCACGGCGAGGGCCCGTCCCCCCACCCGAACGCGACCCCAGGTCAGGCGGGG

Taxonomic Information

Plant ID: NPO25538
Plant Latin Name: Senegalia Pennata
Taxonomy Genus: Senegalia
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1341699
Plant-of-the-World-Online: 77125575-1

Used in Medicines

Country/Region:

Ghana; India; Burkina Faso; Laos

Traditional Medicine System:

Indian Folk; Ayurveda; Siddha

Geographical Distribution

Bangladesh; Mauritania; Guinea; Nepal; Laos; Nigeria; Cameroon; Cote d'Ivoire; Benin; Ghana; Australia; Burkina Faso; Togo; China; Thailand; Sierra Leone; Liberia; Mali; Seychelles; Myanmar; India; Senegal; Congo; Sri Lanka

Geographical Distribution

−

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

19 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

3 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC82696

Ingredient ID: NPC73865

Ingredient ID: NPC47521

Ingredient ID: NPC290289

Ingredient ID: NPC287956

Ingredient ID: NPC281774

Ingredient ID: NPC26536

Ingredient ID: NPC255906

Ingredient ID: NPC240429

Ingredient ID: NPC219876

Ingredient ID: NPC212938

Ingredient ID: NPC200684

Ingredient ID: NPC190204

Ingredient ID: NPC188535

Ingredient ID: NPC184536

Ingredient ID: NPC178134

Ingredient ID: NPC177759

Ingredient ID: NPC165967

Ingredient ID: NPC109878

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Show entries

Search:

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Other cytosolic protein	HSPA1A	Heat shock 70 kDa protein 1	P0DMV8	CHEMBL5460
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	NUAK1	NUAK family SNF1-like kinase 1	O60285	CHEMBL5784

Showing 1 to 10 of 21 entries

Previous1 2 3Next

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

Show entries

Search:

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Ellagic Acid (NPC178134)	NP level
NCT04011618	Effect of Ellagic Ácid on the Components of Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Ellagic Acid (NPC178134)	NP level

Showing 1 to 2 of 2 entries

Previous1Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Show entries

Search:

Associated Disease of the Plant	Association Type & Detailed Evidence
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1,KDR,INSR
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	SRC
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	GPR35
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	RECQL,POLB,MET,NUAK1,TEK
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	MET
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	KDR,MET,INSR
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	HSPA1A,SRC,HSPA1B
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	SRC,KDR,EGFR,MET

Showing 1 to 10 of 127 entries

Previous1 2 3 4 5…13Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Senegalia Pennata

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

19 All known Ingredients in Total

3 Ingredients with Acceptable Bioavailablity

8 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acute diabete complication

Acute myeloid leukaemia

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of stomach

Alzheimer disease

Angina pectoris

BCR-ABL1-negative chronic myeloid leukaemia

Biliary tract cancer

Brain cancer

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities