• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Bursaria Spinosa


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CTGCGGAAGGATCATTGTCGATGCCTGCACAGCAGAGCGACCAGCGAACTCGTTTAAACACGCAGGCCGGCGGCGACGGGGGCGACAGCCTCCCCAGCCGCCGGCCCCACGGGCGGGGAGTGCCCCCGGGCGCTGTCCGACCGAAAACAAAACCCCGGCGCGGAACGCGCCAAGGAACTCGAACTGAAATGCACGTCTCCTCCCCCGTTCGCGGGCGGCGGCGGCGTCTTTCCACAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCGGCCCTCCCCGTCCCCGCAGGGGCGCCGAGGGCGAGGGGCGGATACTGGCCTCCCGTGCCCCGGCGCGCGGTTGGCCCAAATGCGAGTCCCCGGCGGCGTACGTCACGACAAGTGGTGGTTGTCAAAGGCCCTCTCGTCATGTCGTGCGGCCGAACGCCTCCGGAGCGATCTCACGTGACCCTGTTGCGCCGTCCCCGGACGCGCGCTCCGA

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGATGCCTGCACAGCAGAGCGACCAGCGAACTCGTTTAAACACGCAGGCCGGCGGCGACGGGGGCGACAGCCTCCCCAGCCGCCGGCCCCACGGGCGGGGAGTGCCCCCGGGCGCTGTCCGACCGAAAACAAAACCCCGGCGCGGAACGCGCCAAGGAACTCGAACTGAAATGCACGTCTCCTCCCCCGTTCGCGGGCGGCGGCGGCGTCTTTCCACAACACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO25529
Plant Latin Name: Bursaria Spinosa
Taxonomy Genus: Bursaria
Taxonomy Family: Pittosporaceae

Plant External Links:

NCBI TaxonomyDB: 105281
Plant-of-the-World-Online: 684293-1

Used in Medicines

Unknown.

Geographical Distribution

Australia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

157 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


115 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

67 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99088

Ingredient ID: NPC95704

Ingredient ID: NPC95031

Ingredient ID: NPC92085

Ingredient ID: NPC91931

Ingredient ID: NPC90040

Ingredient ID: NPC88566

Ingredient ID: NPC86545

Ingredient ID: NPC85813

Ingredient ID: NPC85233

Ingredient ID: NPC79416

Ingredient ID: NPC79056

Ingredient ID: NPC76145

Ingredient ID: NPC72141

Ingredient ID: NPC69394

Ingredient ID: NPC68889

Ingredient ID: NPC66655

Ingredient ID: NPC65959

Ingredient ID: NPC63872

Ingredient ID: NPC53403

Ingredient ID: NPC50715

Ingredient ID: NPC50701

Ingredient ID: NPC49151

Ingredient ID: NPC47781

Ingredient ID: NPC47255

Ingredient ID: NPC46801

Ingredient ID: NPC45782

Ingredient ID: NPC4455

Ingredient ID: NPC40818

Ingredient ID: NPC38497

Ingredient ID: NPC3649

Ingredient ID: NPC32021

Ingredient ID: NPC31290

Ingredient ID: NPC312132

Ingredient ID: NPC311810

Ingredient ID: NPC311529

Ingredient ID: NPC307168

Ingredient ID: NPC306993

Ingredient ID: NPC306296

Ingredient ID: NPC305016

Ingredient ID: NPC29710

Ingredient ID: NPC297054

Ingredient ID: NPC296473

Ingredient ID: NPC29536

Ingredient ID: NPC294548

Ingredient ID: NPC288756

Ingredient ID: NPC282363

Ingredient ID: NPC279865

Ingredient ID: NPC278023

Ingredient ID: NPC277385

Ingredient ID: NPC27657

Ingredient ID: NPC273756

Ingredient ID: NPC27184

Ingredient ID: NPC270549

Ingredient ID: NPC266371

Ingredient ID: NPC263265

Ingredient ID: NPC262505

Ingredient ID: NPC261831

Ingredient ID: NPC259512

Ingredient ID: NPC257188

Ingredient ID: NPC255350

Ingredient ID: NPC252074

Ingredient ID: NPC251666

Ingredient ID: NPC249164

Ingredient ID: NPC248404

Ingredient ID: NPC247844

Ingredient ID: NPC2476

Ingredient ID: NPC245807

Ingredient ID: NPC243925

Ingredient ID: NPC242881

Ingredient ID: NPC241784

Ingredient ID: NPC240504

Ingredient ID: NPC239039

Ingredient ID: NPC236705

Ingredient ID: NPC233209

Ingredient ID: NPC232375

Ingredient ID: NPC227325

Ingredient ID: NPC226973

Ingredient ID: NPC224517

Ingredient ID: NPC223110

Ingredient ID: NPC222781

Ingredient ID: NPC221743

Ingredient ID: NPC22098

Ingredient ID: NPC220615

Ingredient ID: NPC219738

Ingredient ID: NPC216919

Ingredient ID: NPC216630

Ingredient ID: NPC215932

Ingredient ID: NPC214285

Ingredient ID: NPC213749

Ingredient ID: NPC212819

Ingredient ID: NPC209970

Ingredient ID: NPC205959

Ingredient ID: NPC205522

Ingredient ID: NPC202977

Ingredient ID: NPC201547

Ingredient ID: NPC201057

Ingredient ID: NPC196832

Ingredient ID: NPC196439

Ingredient ID: NPC191184

Ingredient ID: NPC190771

Ingredient ID: NPC188261

Ingredient ID: NPC18351

Ingredient ID: NPC182840

Ingredient ID: NPC18205

Ingredient ID: NPC179831

Ingredient ID: NPC179540

Ingredient ID: NPC17810

Ingredient ID: NPC177148

Ingredient ID: NPC176819

Ingredient ID: NPC176775

Ingredient ID: NPC174360

Ingredient ID: NPC173695

Ingredient ID: NPC173295

Ingredient ID: NPC169407

Ingredient ID: NPC168855

Ingredient ID: NPC168602

Ingredient ID: NPC167815

Ingredient ID: NPC167010

Ingredient ID: NPC165651

Ingredient ID: NPC164964

Ingredient ID: NPC164487

Ingredient ID: NPC163556

Ingredient ID: NPC162050

Ingredient ID: NPC160961

Ingredient ID: NPC158824

Ingredient ID: NPC154480

Ingredient ID: NPC154176

Ingredient ID: NPC149184

Ingredient ID: NPC147723

Ingredient ID: NPC146165

Ingredient ID: NPC145379

Ingredient ID: NPC142860

Ingredient ID: NPC142366

Ingredient ID: NPC13933

Ingredient ID: NPC138932

Ingredient ID: NPC138867

Ingredient ID: NPC138397

Ingredient ID: NPC138360

Ingredient ID: NPC132428

Ingredient ID: NPC129680

Ingredient ID: NPC128726

Ingredient ID: NPC12664

Ingredient ID: NPC12509

Ingredient ID: NPC120253

Ingredient ID: NPC120163

Ingredient ID: NPC116994

Ingredient ID: NPC116502

Ingredient ID: NPC116315

Ingredient ID: NPC116260

Ingredient ID: NPC110639

Ingredient ID: NPC108663

Ingredient ID: NPC104323

Ingredient ID: NPC103711

Ingredient ID: NPC103213

Ingredient ID: NPC10286

Ingredient ID: NPC101294