• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Levisticum Officinale


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCAATAGCAGAATGACCCGCTAACATGTAAACACGTCGGGCAAGCATCGGGGGCCTTTGGTCCCTTGTTTGCGAACCCTGGTAGGTGGTCCCTCTCAAGTGGCCATCGGCCTGCGAAATCATTTGGGCGCGGAATGCGCCAAGGAACTTAAAATTGAATTGTATGTCTGCATCCCGTTAGTGGGTAGCGGCGTCATTCCAAAATACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTAGGCTCAGGGCACGTCTGCCTGGGTGTCACGCATCATCTTTGCCCACAACCACTCACTCCTCGAGGAGCTGTGCTGGGTTGGGGGCGGAATTTGGCCTCCCGTGCCTTGTTGTGCGGTTGGCGCAAAAGTGAGTCTCCGGCGATGGATGTCACGACATTGGTGGTTTTAAAAGACCCTCATGTCTTGTCGCGCGAATCCGCGTCATCTTAGTGAGCTCTAGGACCCTTAGGTGGCACAGACTCTGTGCGCTTCGA

Click for details-----ITS1

CTGCGGAAGGATCATTGTCGAATCCTGCGATAGCAGAACGACCCGCTAACATGTAAACACGTCGGGCAAGCATCGGGGGCCTTTGGTCCCTTGTTTGCGAACCCTGGTAGGTGGTCCCTCTCAAGTGGCCATCGGCCTGCGAAATCATTTGGGCGCGGAATGCGCCAAGGAACTTAAAATTGAATTGTATGTCTGCATCCCGTTAGTGGGTAGCGGCGTCATTCCAAAATACAA

Click for details-----ITS2

ATCATCTTTGCCCACAACCACTCACTCCTCGAGGAGCTGTGCTGGGTTGGGGGCGGAATTTGGCCTCCCGTGCCTTGTTGTGCGGTTGGCGCAAAAGTGAGTCTCCGGCGATGGATGTCACGACATTGGTGGTTTTAAAAGACCCTCATGTCTTGTCGCGCGAATCCGCGTCATCTTAGTGAGCTCTAGGACCCTTAGGTGGCACAGACTCTGTGCGCTTCGA
Taxonomic Information

Plant ID: NPO25369
Plant Latin Name: Levisticum Officinale
Taxonomy Genus: Levisticum
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 48042
Plant-of-the-World-Online: 844187-1

Used in Medicines

Country/Region:
Switzerland; Finland; China; Bulgaria

Traditional Medicine System:
TCM


Medicinal Functions:

Antispasmodic; Aromatic; Carminative; Diaphoretic; Digestive; Diuretic; Emmenagogue; Expectorant; Skin; Stimulant; Stomachic

Geographical Distribution

Italy; France; Norway; Belarus; Iran; China; Belgium; Germany; Spain; Ukraine; Netherlands; Denmark; Poland; Finland; United States; Sweden; Switzerland; Russia; Bulgaria; Romania; Albania; Austria; Hungary

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

68 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

34 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99734

Ingredient ID: NPC90226

Ingredient ID: NPC86892

Ingredient ID: NPC86509

Ingredient ID: NPC83628

Ingredient ID: NPC78551

Ingredient ID: NPC74539

Ingredient ID: NPC72735

Ingredient ID: NPC70741

Ingredient ID: NPC66655

Ingredient ID: NPC58970

Ingredient ID: NPC57488

Ingredient ID: NPC51843

Ingredient ID: NPC51146

Ingredient ID: NPC490066

Ingredient ID: NPC37622

Ingredient ID: NPC34764

Ingredient ID: NPC33320

Ingredient ID: NPC301771

Ingredient ID: NPC296337

Ingredient ID: NPC296165

Ingredient ID: NPC292559

Ingredient ID: NPC289758

Ingredient ID: NPC287182

Ingredient ID: NPC286774

Ingredient ID: NPC277

Ingredient ID: NPC275462

Ingredient ID: NPC26906

Ingredient ID: NPC268130

Ingredient ID: NPC260242

Ingredient ID: NPC252539

Ingredient ID: NPC252222

Ingredient ID: NPC243509

Ingredient ID: NPC233743

Ingredient ID: NPC227031

Ingredient ID: NPC22098

Ingredient ID: NPC218109

Ingredient ID: NPC216145

Ingredient ID: NPC213749

Ingredient ID: NPC212124

Ingredient ID: NPC21123

Ingredient ID: NPC20791

Ingredient ID: NPC202189

Ingredient ID: NPC198381

Ingredient ID: NPC197396

Ingredient ID: NPC195357

Ingredient ID: NPC189853

Ingredient ID: NPC180871

Ingredient ID: NPC173996

Ingredient ID: NPC171295

Ingredient ID: NPC166362

Ingredient ID: NPC163533

Ingredient ID: NPC160240

Ingredient ID: NPC1507

Ingredient ID: NPC144321

Ingredient ID: NPC144023

Ingredient ID: NPC141194

Ingredient ID: NPC14079

Ingredient ID: NPC138113

Ingredient ID: NPC135073

Ingredient ID: NPC133600

Ingredient ID: NPC128529

Ingredient ID: NPC124259

Ingredient ID: NPC121364

Ingredient ID: NPC116775

Ingredient ID: NPC111897

Ingredient ID: NPC105246

Ingredient ID: NPC100986