• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Rheum Coreanum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGTCGAAACCTGCATAAGCAGACAAACCCACAAACACATTTCTAACTAAATGTGTGTCATGATTGATGCCTCGCCTCCTATTGGGATGAGCTCCCCCCGACGCGTGCTAACCCAACCCCGATGCAGATTGTGCCAAGGACTATGAACAATAGCGCACCCCGCAGGAACCAGGAGACTGGGCTTGCGCGGTGGCGTCGTGTCATTTCTACTTCAAAATAAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACACCGCATCACCCCCTCCCGCTCTGAGGTGAGTGGGGCAGAGACTGGCCCTCCATGTGCTCCCGCACGCGGTCGGACTAAATGCCCCTGTGGCTGTGAAATGTCGTGATGATTGGTGGTGAACCAGTGGCCTCATTCCGCGATGCATATCAATGTCATGGCCTCCGTGGCCCTCAGGTGCTCAAGGGTCCCCGAACCTTTGGTTCTCTGTTGC

Click for details-----ITS1

TGTCGAAACCTGCATAAGCAGACAAACCCACAAACACATTTCTAACTAAATGTGTGTCATGATTGATGCCTCGCCTCCTATTGGGATGAGCTCCCCCCGACGCGTGCTAACCCAACCCCGATGCAGATTGTGCCAAGGACTATGAACAATAGCGCACCCCGCAGGAACCAGGAGACTGGGCTTGCGCGGTGGCGTCGTGTCATTTCTACTTCAAAATAAAA

Click for details-----ITS2

ACCGCGTCGCCCCCGCCCCCTCCCGGGGGTCGGGGCGGAGACTGGACCCTGTGCGCCCCAGCGCACGGTCGGAATAAATGTAGGCTCCGCGGCCACGAGAAGCCACGATGATTGGTGGTGTACCATCGCCCCCGTGCCGCGAAGCATCGTGTCGCATCTCGCCCGGCCCCCGGGCGCCAAAGCCCCCCCCCCCTCCCCCCCGTGTGATGACCACCGTTGC
Taxonomic Information

Plant ID: NPO25238
Plant Latin Name: Rheum Coreanum
Taxonomy Genus: Rheum
Taxonomy Family: Polygonaceae

Plant External Links:

NCBI TaxonomyDB: 240185
Plant-of-the-World-Online: n.a.

Used in Medicines

Unknown.

Geographical Distribution
Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

105 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


39 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

70 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98777

Ingredient ID: NPC98583

Ingredient ID: NPC94076

Ingredient ID: NPC92999

Ingredient ID: NPC92403

Ingredient ID: NPC91478

Ingredient ID: NPC89088

Ingredient ID: NPC84568

Ingredient ID: NPC83703

Ingredient ID: NPC83300

Ingredient ID: NPC79056

Ingredient ID: NPC76112

Ingredient ID: NPC73137

Ingredient ID: NPC71579

Ingredient ID: NPC70744

Ingredient ID: NPC70622

Ingredient ID: NPC68324

Ingredient ID: NPC66052

Ingredient ID: NPC61477

Ingredient ID: NPC5029

Ingredient ID: NPC48130

Ingredient ID: NPC44328

Ingredient ID: NPC43812

Ingredient ID: NPC38779

Ingredient ID: NPC36357

Ingredient ID: NPC34864

Ingredient ID: NPC3415

Ingredient ID: NPC312929

Ingredient ID: NPC310757

Ingredient ID: NPC308597

Ingredient ID: NPC305415

Ingredient ID: NPC300684

Ingredient ID: NPC300274

Ingredient ID: NPC299379

Ingredient ID: NPC296920

Ingredient ID: NPC294902

Ingredient ID: NPC294226

Ingredient ID: NPC289322

Ingredient ID: NPC288411

Ingredient ID: NPC288089

Ingredient ID: NPC287349

Ingredient ID: NPC284498

Ingredient ID: NPC282923

Ingredient ID: NPC278329

Ingredient ID: NPC267262

Ingredient ID: NPC264735

Ingredient ID: NPC262911

Ingredient ID: NPC261619

Ingredient ID: NPC260000

Ingredient ID: NPC25637

Ingredient ID: NPC254847

Ingredient ID: NPC250828

Ingredient ID: NPC248573

Ingredient ID: NPC247364

Ingredient ID: NPC246469

Ingredient ID: NPC2458

Ingredient ID: NPC243728

Ingredient ID: NPC243089

Ingredient ID: NPC240074

Ingredient ID: NPC239312

Ingredient ID: NPC238629

Ingredient ID: NPC237435

Ingredient ID: NPC234364

Ingredient ID: NPC232084

Ingredient ID: NPC225710

Ingredient ID: NPC225346

Ingredient ID: NPC225243

Ingredient ID: NPC224765

Ingredient ID: NPC219876

Ingredient ID: NPC218866

Ingredient ID: NPC206800

Ingredient ID: NPC202666

Ingredient ID: NPC198260

Ingredient ID: NPC19256

Ingredient ID: NPC191626

Ingredient ID: NPC179969

Ingredient ID: NPC179126

Ingredient ID: NPC178851

Ingredient ID: NPC177058

Ingredient ID: NPC171280

Ingredient ID: NPC162822

Ingredient ID: NPC161571

Ingredient ID: NPC160512

Ingredient ID: NPC158157

Ingredient ID: NPC15658

Ingredient ID: NPC155297

Ingredient ID: NPC152538

Ingredient ID: NPC147418

Ingredient ID: NPC146973

Ingredient ID: NPC145708

Ingredient ID: NPC142860

Ingredient ID: NPC141078

Ingredient ID: NPC137816

Ingredient ID: NPC129815

Ingredient ID: NPC129002

Ingredient ID: NPC126029

Ingredient ID: NPC125445

Ingredient ID: NPC1249

Ingredient ID: NPC121133

Ingredient ID: NPC114327

Ingredient ID: NPC114179

Ingredient ID: NPC108455

Ingredient ID: NPC1075

Ingredient ID: NPC103299

Ingredient ID: NPC101430