• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Magnolia Sprengeri


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCAAGGCCCGTCGAGCAACGAGACTCGCGAACCGGTGACCCTAACGAGACGCGCGTGGCTCAGGGAGCGCGGTGCCGCCTGCTCTCTCGAGGGACCACGCAGTGAACCACCCCAGGCCCGATTGGCGCCAAGGAATTGAGATGGAATGAACCCGGCTCCCTTTGAGGATGCCGGCATGCGTTCAAAAATTACACAACTCTCAGCAACGGATATCTTTGCTCTCGTATCAATAAAGAACGTAACGAAATGCAATACTTGGTGTGAATTACAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTGGTGCCTGAGGCCACTCTGCTAAGGGTACGCCTACCTGGGCATCATGCATCGTGCTGCCCCACCAGGCGTTCAGCTCATCCGGCGGTGGCGTCGCGTGGCGGAGACTAGCCACCCGTGTGCCCTGTGCGCATGGCCGGCTGAAAAGCATTCACTCCCTCGCCGTGATACGGACGCGGTGGTAGGTGGTTTGAGAGGCGACTACC

Click for details-----ITS1

TCAAGGCCCGTCGAGCAACGAGACTCGCGAACCGGTGACCCTAACGAGACGCGCGTGGCTCAGGGAGCGCGGTGCCGCCTGCTCTCTCGAGGGACCACGCAGTGAACCACCCCAGGCCCGATTGGCGCCAAGGAATTGAGATGGAATGAACCCGGCTCCCTTTGAGGATGCCGGCATGCGTTCAAAAATTACA

Click for details-----ITS2

ACCGTGCTGCCCCACCCGGCGCTCGCCCCATCCGGCGGCGGCGCCCCCGCGGGGCGGAGACTGGCCGCCCGTGCGCCCCCCGCGCGCGGCCGGCTGAAAAGCATTCGCTCCCCCGCCGGGGCGCGGACGCGGCGGTAGGTGGTTTGAGAGGCGGCAGCCTCGTCGGAGCCCGGACGCCGCGCCCGTCTCCCCGGGGCAAAGCAAAGAGCGAAGTGGCACCCMGCCCGGCCGCCCCGCGCGGCCCTCGCG
Taxonomic Information

Plant ID: NPO25197
Plant Latin Name: Magnolia Sprengeri
Taxonomy Genus: Magnolia
Taxonomy Family: Magnoliaceae

Plant External Links:

NCBI TaxonomyDB: 86737
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

147 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


119 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

68 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99480

Ingredient ID: NPC9880

Ingredient ID: NPC95675

Ingredient ID: NPC95594

Ingredient ID: NPC90829

Ingredient ID: NPC88566

Ingredient ID: NPC87828

Ingredient ID: NPC86939

Ingredient ID: NPC85694

Ingredient ID: NPC85386

Ingredient ID: NPC83670

Ingredient ID: NPC82862

Ingredient ID: NPC82111

Ingredient ID: NPC81218

Ingredient ID: NPC80980

Ingredient ID: NPC78551

Ingredient ID: NPC76817

Ingredient ID: NPC76145

Ingredient ID: NPC74595

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC67986

Ingredient ID: NPC61828

Ingredient ID: NPC61769

Ingredient ID: NPC60556

Ingredient ID: NPC57877

Ingredient ID: NPC54264

Ingredient ID: NPC52230

Ingredient ID: NPC51700

Ingredient ID: NPC50629

Ingredient ID: NPC49627

Ingredient ID: NPC49599

Ingredient ID: NPC46705

Ingredient ID: NPC42853

Ingredient ID: NPC41180

Ingredient ID: NPC40702

Ingredient ID: NPC34902

Ingredient ID: NPC34440

Ingredient ID: NPC3155

Ingredient ID: NPC309182

Ingredient ID: NPC30583

Ingredient ID: NPC305327

Ingredient ID: NPC304741

Ingredient ID: NPC30430

Ingredient ID: NPC300725

Ingredient ID: NPC30025

Ingredient ID: NPC29883

Ingredient ID: NPC293343

Ingredient ID: NPC292340

Ingredient ID: NPC291100

Ingredient ID: NPC289366

Ingredient ID: NPC289196

Ingredient ID: NPC287660

Ingredient ID: NPC287331

Ingredient ID: NPC281131

Ingredient ID: NPC270689

Ingredient ID: NPC26906

Ingredient ID: NPC268574

Ingredient ID: NPC266061

Ingredient ID: NPC264317

Ingredient ID: NPC263548

Ingredient ID: NPC258672

Ingredient ID: NPC256848

Ingredient ID: NPC255042

Ingredient ID: NPC254156

Ingredient ID: NPC253662

Ingredient ID: NPC252921

Ingredient ID: NPC24824

Ingredient ID: NPC247786

Ingredient ID: NPC246165

Ingredient ID: NPC244858

Ingredient ID: NPC242965

Ingredient ID: NPC239966

Ingredient ID: NPC239039

Ingredient ID: NPC231738

Ingredient ID: NPC23117

Ingredient ID: NPC227670

Ingredient ID: NPC227378

Ingredient ID: NPC227160

Ingredient ID: NPC225723

Ingredient ID: NPC225710

Ingredient ID: NPC225616

Ingredient ID: NPC22463

Ingredient ID: NPC22229

Ingredient ID: NPC222127

Ingredient ID: NPC220860

Ingredient ID: NPC215632

Ingredient ID: NPC214584

Ingredient ID: NPC213749

Ingredient ID: NPC210560

Ingredient ID: NPC209275

Ingredient ID: NPC20791

Ingredient ID: NPC19488

Ingredient ID: NPC19460

Ingredient ID: NPC190889

Ingredient ID: NPC188238

Ingredient ID: NPC187158

Ingredient ID: NPC18449

Ingredient ID: NPC184049

Ingredient ID: NPC182840

Ingredient ID: NPC178383

Ingredient ID: NPC178290

Ingredient ID: NPC178134

Ingredient ID: NPC177112

Ingredient ID: NPC175987

Ingredient ID: NPC173996

Ingredient ID: NPC173228

Ingredient ID: NPC172833

Ingredient ID: NPC169749

Ingredient ID: NPC168058

Ingredient ID: NPC166362

Ingredient ID: NPC165651

Ingredient ID: NPC1656

Ingredient ID: NPC159733

Ingredient ID: NPC157298

Ingredient ID: NPC152438

Ingredient ID: NPC150329

Ingredient ID: NPC148303

Ingredient ID: NPC143956

Ingredient ID: NPC143639

Ingredient ID: NPC143095

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139546

Ingredient ID: NPC139274

Ingredient ID: NPC138347

Ingredient ID: NPC136232

Ingredient ID: NPC131981

Ingredient ID: NPC131769

Ingredient ID: NPC129489

Ingredient ID: NPC127684

Ingredient ID: NPC126240

Ingredient ID: NPC124885

Ingredient ID: NPC122487

Ingredient ID: NPC121171

Ingredient ID: NPC12053

Ingredient ID: NPC116775

Ingredient ID: NPC116518

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC109838

Ingredient ID: NPC109813

Ingredient ID: NPC107775

Ingredient ID: NPC10455

Ingredient ID: NPC102781

Ingredient ID: NPC102332

Ingredient ID: NPC10187