CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Helichrysum Italicum

Example Image

PLANiTS DNA barcode

TGCGGAAGGATCATTGTCGAACCCTGCAAAGCAGAACGACCCGTGAACATGTAACTACAACTAGGCGAGCTAGGGATTGAGCTTCTGCTTGATCCTTAGCTGCCTTGTTGATGTGCGTTCGAGATTCCTTATGGATGATTGGATGTCACATTGACAATCTAACCAACCCCGGCATGGAATGTGCCAAGGAAATTAAAACTTTAGGAATGGAAGTTTCATTATGTCCCGTTTTGCGGTGCACTATTGAAACTTTACTTCTTTGTAATCACAAA

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO25148
Plant Latin Name: Helichrysum Italicum
Taxonomy Genus: Helichrysum
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 261786
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Italy; Greece

Traditional Medicine System:

Geographical Distribution

Italy; Greece

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

31 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

20 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC98667

Ingredient ID: NPC939

Ingredient ID: NPC90156

Ingredient ID: NPC88886

Ingredient ID: NPC473767

Ingredient ID: NPC471422

Ingredient ID: NPC39409

Ingredient ID: NPC32368

Ingredient ID: NPC302857

Ingredient ID: NPC298675

Ingredient ID: NPC296783

Ingredient ID: NPC295970

Ingredient ID: NPC29124

Ingredient ID: NPC279732

Ingredient ID: NPC265442

Ingredient ID: NPC251320

Ingredient ID: NPC245546

Ingredient ID: NPC242136

Ingredient ID: NPC238384

Ingredient ID: NPC217635

Ingredient ID: NPC195675

Ingredient ID: NPC175804

Ingredient ID: NPC175275

Ingredient ID: NPC141761

Ingredient ID: NPC13768

Ingredient ID: NPC127092

Ingredient ID: NPC127074

Ingredient ID: NPC123818

Ingredient ID: NPC121100

Ingredient ID: NPC108278

Ingredient ID: NPC104172

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 2	CYP2C19	Cytochrome P450 2C19	P33261	CHEMBL3622
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Oxidoreductase	AKR1B10	Aldo-keto reductase family 1 member B10	O60218	CHEMBL5983

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	6
Plant level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02136342	Phase 1 Trial of Chlorogenic Acid in Patients With Advanced Cancer	cancer	Chlorogenic Acid (NPC302857)	NP level
NCT02728349	Tolerance and Pharmacokinetic Study of Chlorogenic Acid to Advanced Glioblastoma	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT02621060	Effect of Chlorogenic Acid on Patients With Impaired Glucose Tolerance	abnormal glucose tolerance	Chlorogenic Acid (NPC302857)	NP level
NCT02245204	Phase I Studies of Chlorogenic Acid for Injection for Tolerance and Pharmacokinetic of Advanced Cancers	cancer	Chlorogenic Acid (NPC302857)	NP level
NCT03758014	Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Grade IV GBM Patients	glioblastoma multiforme	Chlorogenic Acid (NPC302857)	NP level
NCT04866628	Clinical Trials of Two Helichrysum Infusions in Adults	Hypertension\|Hyperlipidemias\|Inflammation\|Hyperglycemia\|Hypercholesterolemia\|Microbial Colonization\|Overweight and Obesity	Helichrysum Italicum	Plant level As single plant
NCT03751592	Phase Ib/IIa Studies of Chlorogenic Acid for Injection for Safety and Efficacy of Advanced Lung Cancer	lung cancer	Chlorogenic Acid (NPC302857)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT02136342,NCT02245204
Glioblastoma, primary, NOS Disease Category: X.Extension Codes Disease ICD-11 Code: XH0MB1	NCT03758014,NCT02728349
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	AKR1B10,AKR1B1
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B10,AKR1B1
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B10,AKR1B1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	AKR1B10,CYP2C19
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1B10,AKR1B10
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	AKR1B10,AKR1B1
Hypercholesterolaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80.0	NCT04866628
Elevated blood glucose level Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MA18.0	NCT04866628
Hyperlipoproteinaemia, unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80.Z	NCT04866628
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	NCT04866628
NA Disease Category: NA Disease ICD-11 Code: NA	NCT04866628
Overweight, obesity or specific nutrient excesses, unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C1Z	NCT04866628
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	AKR1B1
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	AKR1B1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	AKR1B1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	NCT03751592
Impaired glucose tolerance Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A40.1	NCT02621060
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	AKR1B10
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	AKR1B1
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	AKR1B10
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	AKR1B1
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	AKR1B10
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1B10
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	AKR1B10
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1B10
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CYP2C19
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1B10
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	AKR1B10
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	AKR1B10
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	AKR1B1
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Helichrysum Italicum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

31 All known Ingredients in Total

20 Ingredients with Acceptable Bioavailablity

19 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Unspecified malignant neoplasms of unspecified sites

Glioblastoma, primary, NOS

Carcinosarcoma of uterus

Hepatoblastoma

Leishmaniasis

Adenocarcinoma of pancreas

Hepatocellular carcinoma of liver

Malignant neoplasms of thymus

Hypercholesterolaemia

Elevated blood glucose level

Hyperlipoproteinaemia, unspecified

Pulmonary hypertension

NA

Overweight, obesity or specific nutrient excesses, unspecified

Acute diabete complication

Neuropathy

Glaucoma

Cataract

Pain, unspecified

Rheumatoid arthritis

Thrombosis

Schizophrenia

Lung cancer

Impaired glucose tolerance

Serous cystadenoma,borderline malignancy of ovary

Malignant neoplasms of biliary tract, distal bile duct

Psoriasis

Diffuse large B-cell lymphomas

Other specified malignant neoplasms of kidney, except renal pelvis

Squamous cell carcinoma of bronchus or lung

Mesothelioma of pleura

Other specified malignant neoplasms of bronchus or lung

Urothelial carcinoma of bladder

Cytomegaloviral disease

Adenocarcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Glioblastoma of brain

Germ cell tumour of testis

Gliomas of brain

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities