• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Conium Maculatum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCGATGGCAGAATGACCCGCTAACACGTATACACATCGGACAAGCGTCAGGGGGCTTTTGTCCCCTGTTAGCGAATCCCTGGTAGGTGGCCCTCTCGGGTGGCCACTGGCCTGCAAAATCATTTGGGCGCGGAATGTGCCAAGGAACATAAAACTGAATTGTACGCCCGCTTCCCGTTAACGGGCAGCGGCGTCATTCCAAAACACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATTGTCTTGCCCACAAACACAGACACTCCTCAAGGATTTGTGCCTGGTTTGGGGGCGGAAATTGGCCTCCCGTGACTTGTTGCGCGGTTGGCAAAAAAATGAGTCTCCGGCGACGGACGTCGTGACAACGGTGGTTGTAAAAGACCCTCTTGAATTGTTGCGCGAATCCGCGTCATCTTAGCGAGCTCTAGGACCCTTAGGCGGCACACACTCTGTGCGCTTCGACTGTGACCCCCGTGGTCGCGTGGGGGTTGGCCCCGGGAC

Click for details-----ITS1

TCGGCGGGCGGGGGCCGGGGAGACCGAGTTGTCGATCCTGCGATGGCAGAATGACCCGCTAACACGTATACACATCGGACAAGCGTCAGGGGGCTTTTGTCCCCTGTTAGCGAATCCCTGGTAGGTGGCCCTCTCGGGTGGCCACTGGCCTGCAAAATCATTTGGGCGCGGAATGTGCCAAGGAACATAAAACTGAATTGTACGCCCGCTTCCCGTTAACGGGCAGCGGCGTCATTCCAAAACACAA

Click for details-----ITS2

ATTGTCTTGCCCACAAACACACACACTCCTCAAGGATTTGTGCCTGGTTTGGGGGCGGAAATTGGCCTCCCGTGACTTGTTGCGCGGTTGGCAAAAAAATGAGTCTCCGGCGACGGACGTCGTGACAACGGTGGTTGTAAAAGACCCTCTTGAATTGTTGCGCGAATCCGCGTCATCTTAGCGAGCTCTAGGACCCTTAGGCGGCACACACTCTGTGCGCTTCGACTGTGACCCCAGGTCAGGCGGGAC
Taxonomic Information

Plant ID: NPO25122
Plant Latin Name: Conium Maculatum
Taxonomy Genus: Conium
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 13447
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Italy; India; Finland; Lebanon; China; Chile; Argentina; Spain

Traditional Medicine System:
TCM; Homeopathy; Siddha


Medicinal Functions:

Analgesic; Antirheumatic; Antispasmodic; Cancer; Emetic; Galactofuge; Homeopathy; Sedative

Geographical Distribution

Turkey; Italy; Lebanon; Finland; India; China; Chile; Argentina; Spain

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

68 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


67 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

30 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93433

Ingredient ID: NPC91871

Ingredient ID: NPC87725

Ingredient ID: NPC85726

Ingredient ID: NPC80103

Ingredient ID: NPC78445

Ingredient ID: NPC76336

Ingredient ID: NPC74331

Ingredient ID: NPC73369

Ingredient ID: NPC71778

Ingredient ID: NPC71376

Ingredient ID: NPC60348

Ingredient ID: NPC53639

Ingredient ID: NPC52086

Ingredient ID: NPC51959

Ingredient ID: NPC51717

Ingredient ID: NPC49555

Ingredient ID: NPC37947

Ingredient ID: NPC35700

Ingredient ID: NPC35300

Ingredient ID: NPC34770

Ingredient ID: NPC34103

Ingredient ID: NPC304761

Ingredient ID: NPC294902

Ingredient ID: NPC290598

Ingredient ID: NPC288943

Ingredient ID: NPC284323

Ingredient ID: NPC283770

Ingredient ID: NPC279921

Ingredient ID: NPC274505

Ingredient ID: NPC271985

Ingredient ID: NPC269367

Ingredient ID: NPC262725

Ingredient ID: NPC25772

Ingredient ID: NPC250476

Ingredient ID: NPC241465

Ingredient ID: NPC241055

Ingredient ID: NPC241025

Ingredient ID: NPC240722

Ingredient ID: NPC239729

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC226618

Ingredient ID: NPC225665

Ingredient ID: NPC225661

Ingredient ID: NPC224673

Ingredient ID: NPC20610

Ingredient ID: NPC205689

Ingredient ID: NPC205372

Ingredient ID: NPC19121

Ingredient ID: NPC186237

Ingredient ID: NPC182432

Ingredient ID: NPC167539

Ingredient ID: NPC160100

Ingredient ID: NPC154792

Ingredient ID: NPC145879

Ingredient ID: NPC145054

Ingredient ID: NPC13789

Ingredient ID: NPC131885

Ingredient ID: NPC127816

Ingredient ID: NPC12210

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC109418

Ingredient ID: NPC10789

Ingredient ID: NPC1075

Ingredient ID: NPC102516

Ingredient ID: NPC100079