• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Linum Usitatissimum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CCTGGTTTAATCTTTGCTCAGGCAGATGACCAGCGAACATGTCGTTAAATGCGGGGGAGGCCGAAGCTGGGTGTGCTTCTAGGGCCACCACGCCGAGTCCTCGCCCGGTGGGGGCTTTGGCTTAACTGTCAAGTCTCTGCCAACAAACTAACAAACCCCGGCACGGAATGTGCCAAGGAATACTCTTAGTGACGATGTGTCTCGTGCCCATTCACGGCGTGCGGGATGCATTGACCCACCACGAATATACAATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCTGAAGCCATTTGGCTGAGGGCACGTCTGCCTGGGTGTCACACAACGTCGCCCCACCCCCAGGATCTGGGACGGTGCGGATGTTGGCCTCCCGACAGCTCGAAAGGGCCACACGGCTGGCCGAAATGAAAGTCGTCGGCGAGGGATGCCACGGTGAGCTGTGGTTGACATGACACTACTATGGTATTGTAGCCGTGAGCGGTTCCTTGTCGGCTGCTAAGTGATGGACCGAGAGGGGCCTAGGCCTTTTTAAC

Click for details-----ITS1

CCTGGTTTAATCTTTGCTCAGGCAGATGACCAGCGAACATGTCGTTAAATGCGGGGGAGGCCGAAGCTGGGTGTGCTTCTAGGGCCACCACGCCGAGTCCTCGCCCGGTGGGGGCTTTGGCTTAACTGTCAAGTCTCTGCCAACAAACTAACAAACCCCGGCACGGAATGTGCCAAGGAATACTCTTAGTGACGATGTGTCTCGTGCCCATTCACGGCGTGCGGGATGCATTGACCCACCACGAATATACAATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO25114
Plant Latin Name: Linum Usitatissimum
Taxonomy Genus: Linum
Taxonomy Family: Linaceae

Plant External Links:

NCBI TaxonomyDB: 4006
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Turkey; Canada; Italy; India; Finland; Lebanon; Jordan; Chile; China; Argentina; Iraq; Spain; Bulgaria

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy


Medicinal Functions:

Analgesic; Cancer; Cardiotonic; Demulcent; Emollient; Expectorant; Laxative; Nervine; Pectoral; Resolvent; VD

Geographical Distribution

Canada; Turkey; Italy; Lebanon; Finland; India; China; Chile; Jordan; Argentina; Iraq; Spain; Bulgaria

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

231 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


147 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

134 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97820

Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC85813

Ingredient ID: NPC85488

Ingredient ID: NPC84281

Ingredient ID: NPC81806

Ingredient ID: NPC81010

Ingredient ID: NPC8086

Ingredient ID: NPC78312

Ingredient ID: NPC77272

Ingredient ID: NPC76308

Ingredient ID: NPC75726

Ingredient ID: NPC7551

Ingredient ID: NPC7106

Ingredient ID: NPC70744

Ingredient ID: NPC69496

Ingredient ID: NPC68779

Ingredient ID: NPC67118

Ingredient ID: NPC65310

Ingredient ID: NPC64434

Ingredient ID: NPC62045

Ingredient ID: NPC60175

Ingredient ID: NPC59650

Ingredient ID: NPC58478

Ingredient ID: NPC57863

Ingredient ID: NPC491304

Ingredient ID: NPC490453

Ingredient ID: NPC490427

Ingredient ID: NPC490321

Ingredient ID: NPC490288

Ingredient ID: NPC490175

Ingredient ID: NPC490014

Ingredient ID: NPC489910

Ingredient ID: NPC489909

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489904

Ingredient ID: NPC489903

Ingredient ID: NPC489899

Ingredient ID: NPC48886

Ingredient ID: NPC48623

Ingredient ID: NPC479076

Ingredient ID: NPC479075

Ingredient ID: NPC479074

Ingredient ID: NPC479073

Ingredient ID: NPC479072

Ingredient ID: NPC479071

Ingredient ID: NPC479070

Ingredient ID: NPC479069

Ingredient ID: NPC479068

Ingredient ID: NPC479067

Ingredient ID: NPC479066

Ingredient ID: NPC479065

Ingredient ID: NPC46780

Ingredient ID: NPC424

Ingredient ID: NPC40432

Ingredient ID: NPC39633

Ingredient ID: NPC39426

Ingredient ID: NPC38751

Ingredient ID: NPC37468

Ingredient ID: NPC36061

Ingredient ID: NPC35565

Ingredient ID: NPC35181

Ingredient ID: NPC33541

Ingredient ID: NPC32977

Ingredient ID: NPC3295

Ingredient ID: NPC328447

Ingredient ID: NPC323810

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC31385

Ingredient ID: NPC307176

Ingredient ID: NPC307050

Ingredient ID: NPC306990

Ingredient ID: NPC304309

Ingredient ID: NPC301865

Ingredient ID: NPC301585

Ingredient ID: NPC294902

Ingredient ID: NPC294548

Ingredient ID: NPC291027

Ingredient ID: NPC290613

Ingredient ID: NPC290563

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC289536

Ingredient ID: NPC288963

Ingredient ID: NPC287707

Ingredient ID: NPC28657

Ingredient ID: NPC284475

Ingredient ID: NPC281686

Ingredient ID: NPC280749

Ingredient ID: NPC279026

Ingredient ID: NPC278976

Ingredient ID: NPC278961

Ingredient ID: NPC273254

Ingredient ID: NPC272614

Ingredient ID: NPC270278

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC269823

Ingredient ID: NPC26960

Ingredient ID: NPC267466

Ingredient ID: NPC267423

Ingredient ID: NPC265160

Ingredient ID: NPC262926

Ingredient ID: NPC261831

Ingredient ID: NPC257582

Ingredient ID: NPC248142

Ingredient ID: NPC24700

Ingredient ID: NPC243645

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237946

Ingredient ID: NPC237812

Ingredient ID: NPC236015

Ingredient ID: NPC234378

Ingredient ID: NPC233910

Ingredient ID: NPC230301

Ingredient ID: NPC228346

Ingredient ID: NPC227451

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC225750

Ingredient ID: NPC225227

Ingredient ID: NPC22130

Ingredient ID: NPC221090

Ingredient ID: NPC219143

Ingredient ID: NPC218324

Ingredient ID: NPC216630

Ingredient ID: NPC213876

Ingredient ID: NPC209971

Ingredient ID: NPC209970

Ingredient ID: NPC209773

Ingredient ID: NPC20969

Ingredient ID: NPC209525

Ingredient ID: NPC208793

Ingredient ID: NPC208068

Ingredient ID: NPC207584

Ingredient ID: NPC20742

Ingredient ID: NPC20443

Ingredient ID: NPC203468

Ingredient ID: NPC203064

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC200302

Ingredient ID: NPC200137

Ingredient ID: NPC1982

Ingredient ID: NPC196924

Ingredient ID: NPC19578

Ingredient ID: NPC19572

Ingredient ID: NPC193803

Ingredient ID: NPC191569

Ingredient ID: NPC190558

Ingredient ID: NPC189436

Ingredient ID: NPC188428

Ingredient ID: NPC187998

Ingredient ID: NPC187770

Ingredient ID: NPC185755

Ingredient ID: NPC18509

Ingredient ID: NPC183377

Ingredient ID: NPC182102

Ingredient ID: NPC178263

Ingredient ID: NPC17810

Ingredient ID: NPC1769

Ingredient ID: NPC176599

Ingredient ID: NPC176326

Ingredient ID: NPC176017

Ingredient ID: NPC174246

Ingredient ID: NPC174213

Ingredient ID: NPC172518

Ingredient ID: NPC171736

Ingredient ID: NPC169485

Ingredient ID: NPC1682

Ingredient ID: NPC167744

Ingredient ID: NPC167400

Ingredient ID: NPC167385

Ingredient ID: NPC165967

Ingredient ID: NPC162742

Ingredient ID: NPC161659

Ingredient ID: NPC161557

Ingredient ID: NPC161423

Ingredient ID: NPC161229

Ingredient ID: NPC160900

Ingredient ID: NPC160207

Ingredient ID: NPC158079

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC152451

Ingredient ID: NPC151517

Ingredient ID: NPC150950

Ingredient ID: NPC149803

Ingredient ID: NPC149184

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC144258

Ingredient ID: NPC143326

Ingredient ID: NPC142000

Ingredient ID: NPC140310

Ingredient ID: NPC139545

Ingredient ID: NPC139397

Ingredient ID: NPC137958

Ingredient ID: NPC137784

Ingredient ID: NPC136188

Ingredient ID: NPC136014

Ingredient ID: NPC134252

Ingredient ID: NPC132923

Ingredient ID: NPC132097

Ingredient ID: NPC13206

Ingredient ID: NPC130683

Ingredient ID: NPC130329

Ingredient ID: NPC126681

Ingredient ID: NPC122082

Ingredient ID: NPC120649

Ingredient ID: NPC119381

Ingredient ID: NPC117493

Ingredient ID: NPC117351

Ingredient ID: NPC116631

Ingredient ID: NPC115207

Ingredient ID: NPC11433

Ingredient ID: NPC113776

Ingredient ID: NPC113733

Ingredient ID: NPC113680

Ingredient ID: NPC112890

Ingredient ID: NPC110602

Ingredient ID: NPC108598

Ingredient ID: NPC107914

Ingredient ID: NPC1075

Ingredient ID: NPC10635

Ingredient ID: NPC100971

Ingredient ID: NPC100128