• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Achillea Millefolium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCAAAGCAGAACGACCCGTGAACACGTTAAAACAACTGAGCGTCGAGTGGACTAAGCATCTGTTTGATCCTCTCGATGCTTTGTCGATGTGCATTCACTTGCGTTCTTTTTTGGACCTGGTGAATGTGTCATTGACGCAATAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTTGAGAAGGCTTGTTTCATGTAGCCCCGTTCGCGGTGCGCTCATGGAATGTGGCTTCTTTTTAATTACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAGAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCGGAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCATCAAATCTCTGTTGGGGGCGGATATAGGTCTCCCGAGCTCATGGTGTGGTTGGCCAAAATGGGAGTCCCTTCGAGGGACACACGAACTAATGGTGGTCGTAAAAACCCTCGTTCTTTGTTCTGTGTTAGTCGCAAGGAAAAACTCTTCAAAATACCCCAACGCGTTGTCTTAAGATGACGCTTCGACCGCGACCT

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCATCAAATCTCTGTTGGGGGCGGATATAGGTCTCCCGAGCTCATGGTGTGGTTGGCCAAAATGGGAGTCCCTTCGAGGGACACACGAACTAATGGTGGTCGTAAAAACCCTCGTTCTTTGTTCTGTGTTAGTCGCAAGGAAAAACTCTTCAAAATACCCCAACGCGTTGTCTTAAGATGACGCTTCGACCGCGACCT
Taxonomic Information

Plant ID: NPO25014
Plant Latin Name: Achillea Millefolium
Taxonomy Genus: Achillea
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 13329
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Brazil; Turkey; Israel; Albania; Italy; Canada; India; Finland; Lithuania; Sweden; Vietnam; China; Switzerland; Russia; Spain

Traditional Medicine System:
Unani; TCM; Homeopathy; Siddha


Medicinal Functions:

Antidiarrhoeal; Antiinflammatory; Antiseptic; Antispasmodic; Appetizer; Aromatic; Astringent; Carminative; Cholagogue; Diaphoretic; Digestive; Emmenagogue; Odontalgic; Stimulant; Tonic; Vasodilator; Vulnerary

Geographical Distribution

Brazil; Canada; Israel; Albania; Italy; Lithuania; Turkey; Finland; India; Sweden; Vietnam; China; Switzerland; Russia; Spain

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

88 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


46 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

20 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99453

Ingredient ID: NPC9880

Ingredient ID: NPC9545

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC80866

Ingredient ID: NPC7568

Ingredient ID: NPC75158

Ingredient ID: NPC7472

Ingredient ID: NPC70840

Ingredient ID: NPC59953

Ingredient ID: NPC59425

Ingredient ID: NPC50898

Ingredient ID: NPC46139

Ingredient ID: NPC42579

Ingredient ID: NPC41354

Ingredient ID: NPC4011

Ingredient ID: NPC36151

Ingredient ID: NPC328788

Ingredient ID: NPC326583

Ingredient ID: NPC321461

Ingredient ID: NPC318019

Ingredient ID: NPC317130

Ingredient ID: NPC316301

Ingredient ID: NPC3155

Ingredient ID: NPC310457

Ingredient ID: NPC307125

Ingredient ID: NPC299131

Ingredient ID: NPC294902

Ingredient ID: NPC292971

Ingredient ID: NPC282509

Ingredient ID: NPC277976

Ingredient ID: NPC277693

Ingredient ID: NPC270204

Ingredient ID: NPC264470

Ingredient ID: NPC263428

Ingredient ID: NPC262036

Ingredient ID: NPC259624

Ingredient ID: NPC259152

Ingredient ID: NPC257412

Ingredient ID: NPC257124

Ingredient ID: NPC249806

Ingredient ID: NPC249203

Ingredient ID: NPC247113

Ingredient ID: NPC23941

Ingredient ID: NPC237332

Ingredient ID: NPC234106

Ingredient ID: NPC231660

Ingredient ID: NPC231577

Ingredient ID: NPC230085

Ingredient ID: NPC230048

Ingredient ID: NPC222544

Ingredient ID: NPC218610

Ingredient ID: NPC216308

Ingredient ID: NPC216243

Ingredient ID: NPC213319

Ingredient ID: NPC204838

Ingredient ID: NPC197316

Ingredient ID: NPC196776

Ingredient ID: NPC196490

Ingredient ID: NPC195146

Ingredient ID: NPC190291

Ingredient ID: NPC177702

Ingredient ID: NPC176300

Ingredient ID: NPC173204

Ingredient ID: NPC168271

Ingredient ID: NPC167551

Ingredient ID: NPC167134

Ingredient ID: NPC165287

Ingredient ID: NPC160661

Ingredient ID: NPC159630

Ingredient ID: NPC159097

Ingredient ID: NPC154792

Ingredient ID: NPC14930

Ingredient ID: NPC148213

Ingredient ID: NPC14682

Ingredient ID: NPC145379

Ingredient ID: NPC144566

Ingredient ID: NPC142227

Ingredient ID: NPC135683

Ingredient ID: NPC126240

Ingredient ID: NPC12568

Ingredient ID: NPC122107

Ingredient ID: NPC120468

Ingredient ID: NPC11546

Ingredient ID: NPC1075

Ingredient ID: NPC104195

Ingredient ID: NPC103681