• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Xanthium Strumarium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCACAGCAGAACGACCCGAGAACAAGTAAAAACATCTGGCCGAGCGGGGATCGAAGCTTACGTTTYGAKCCTTGTGAGGCCTTGTTGGCGTGTGTTTRTGCTTGCACCATACATGTGGGGCATCATGGATTTCACGTTGACACACTAACAAACCCCCGGCACGGTACGTGCCAAGGAAAACTAAACTTAAAGGGCCCGTGCTAYTGCGCCCCGCTCGCGGTGTGCGCTTTGTACGTGGCATCTTTCTAAACTAATAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCAYGTCGCCCCCACCACGCCTCCCTTCTAGGGACGTCTTTGGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGCGTGGTTGGCCTAAATAGGAGTCTCCCTAAGAGGGACGCACGRCTAGTGGTGGTTGATAACACAGTCGTCTCGTGTCGTGCGTTTTCATTCTTGGGTGTAGATGCTCTTAAAATACCCTGACGCGTTGTCTTGCGACAGTGCTTCGATC

Click for details-----ITS1

GTGGACCGGTGACTGCCGCAGACGACCCGAGACAAGTAAAAACATCTGGCCGAGCGGGGATCGAAGCTTACGTTTCAAGCCTTGTGAGGCCTTGTTGGCGTGTGTTTATGCTTGCACCATACATGTGGGGCATCATGGATTTCACGTTGACACACTAACAAACCCCCGGCACGGTACGTGCCAAGGAAAACTAAACTTAAAGGGCCCGTGCTATTGCGCCCCGCTCGCGGTGTGCGCTTTGTACGTGGCATCTTTGTAAACTAATAA

Click for details-----ITS2

ATCACGTCGCCCCCACCACGCCTCCCTTCTAGGGACGTCTTTGGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGCGTGGTTGGCCTAAATAGGAGTCTCCCTAAGAGGGACGCACGGCTAGTGGTGGTTGATAACACAGTCGTCTCGTGTCGTGCGTTTTCATTCTTTGGTGTAGATGCTCTTAAAATACCCTGACGCGTTGTCTTGCGACAGTGCTTCGATCGCGACCCCAGGTCAGGCGGGACTAC
Taxonomic Information

Plant ID: NPO2494
Plant Latin Name: Xanthium Strumarium
Taxonomy Genus: Xanthium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 318068
Plant-of-the-World-Online: n.a.

Collective Molecular Activities of the Plant: Xanthium Strumarium


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCACAGCAGAACGACCCGAGAACAAGTAAAAACATCTGGCCGAGCGGGGATCGAAGCTTACGTTTYGAKCCTTGTGAGGCCTTGTTGGCGTGTGTTTRTGCTTGCACCATACATGTGGGGCATCATGGATTTCACGTTGACACACTAACAAACCCCCGGCACGGTACGTGCCAAGGAAAACTAAACTTAAAGGGCCCGTGCTAYTGCGCCCCGCTCGCGGTGTGCGCTTTGTACGTGGCATCTTTCTAAACTAATAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTCCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCAYGTCGCCCCCACCACGCCTCCCTTCTAGGGACGTCTTTGGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGCGTGGTTGGCCTAAATAGGAGTCTCCCTAAGAGGGACGCACGRCTAGTGGTGGTTGATAACACAGTCGTCTCGTGTCGTGCGTTTTCATTCTTGGGTGTAGATGCTCTTAAAATACCCTGACGCGTTGTCTTGCGACAGTGCTTCGATC

Click for details-----ITS1

GTGGACCGGTGACTGCCGCAGACGACCCGAGACAAGTAAAAACATCTGGCCGAGCGGGGATCGAAGCTTACGTTTCAAGCCTTGTGAGGCCTTGTTGGCGTGTGTTTATGCTTGCACCATACATGTGGGGCATCATGGATTTCACGTTGACACACTAACAAACCCCCGGCACGGTACGTGCCAAGGAAAACTAAACTTAAAGGGCCCGTGCTATTGCGCCCCGCTCGCGGTGTGCGCTTTGTACGTGGCATCTTTGTAAACTAATAA

Click for details-----ITS2

ATCACGTCGCCCCCACCACGCCTCCCTTCTAGGGACGTCTTTGGTTGGGGCGGAGATTGGTCTCCCGTGCCCATGGCGTGGTTGGCCTAAATAGGAGTCTCCCTAAGAGGGACGCACGGCTAGTGGTGGTTGATAACACAGTCGTCTCGTGTCGTGCGTTTTCATTCTTTGGTGTAGATGCTCTTAAAATACCCTGACGCGTTGTCTTGCGACAGTGCTTCGATCGCGACCCCAGGTCAGGCGGGACTAC
Taxonomic Information

Plant ID: NPO2494
Plant Latin Name: Xanthium Strumarium
Taxonomy Genus: Xanthium
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 318068
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; India

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Ayurveda; Siddha


Medicinal Functions:

Anodyne; Antibacterial; Antifungal; Antiperiodic; Antirheumatic; Antispasmodic; Antitussive; Appetizer; Cytotoxic; Diaphoretic; Diuretic; Emollient; Febrifuge; Hypoglycaemic; Laxative; Sedative; Stomachic

Geographical Distribution

Thailand; India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

170 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


109 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

79 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC93708

Ingredient ID: NPC92864

Ingredient ID: NPC92774

Ingredient ID: NPC92430

Ingredient ID: NPC91696

Ingredient ID: NPC88804

Ingredient ID: NPC8756

Ingredient ID: NPC85813

Ingredient ID: NPC85597

Ingredient ID: NPC85182

Ingredient ID: NPC83546

Ingredient ID: NPC8313

Ingredient ID: NPC81775

Ingredient ID: NPC76397

Ingredient ID: NPC76336

Ingredient ID: NPC73282

Ingredient ID: NPC70744

Ingredient ID: NPC69906

Ingredient ID: NPC68857

Ingredient ID: NPC67880

Ingredient ID: NPC67288

Ingredient ID: NPC66052

Ingredient ID: NPC6533

Ingredient ID: NPC63649

Ingredient ID: NPC63494

Ingredient ID: NPC63427

Ingredient ID: NPC56144

Ingredient ID: NPC55732

Ingredient ID: NPC486583

Ingredient ID: NPC486582

Ingredient ID: NPC486581

Ingredient ID: NPC486580

Ingredient ID: NPC4574

Ingredient ID: NPC45040

Ingredient ID: NPC43733

Ingredient ID: NPC424

Ingredient ID: NPC42372

Ingredient ID: NPC40432

Ingredient ID: NPC37331

Ingredient ID: NPC37250

Ingredient ID: NPC37164

Ingredient ID: NPC37132

Ingredient ID: NPC34877

Ingredient ID: NPC34103

Ingredient ID: NPC33721

Ingredient ID: NPC32920

Ingredient ID: NPC31412

Ingredient ID: NPC308905

Ingredient ID: NPC305268

Ingredient ID: NPC304502

Ingredient ID: NPC303090

Ingredient ID: NPC303063

Ingredient ID: NPC302857

Ingredient ID: NPC302197

Ingredient ID: NPC301382

Ingredient ID: NPC299175

Ingredient ID: NPC295978

Ingredient ID: NPC294902

Ingredient ID: NPC291158

Ingredient ID: NPC290887

Ingredient ID: NPC289883

Ingredient ID: NPC288667

Ingredient ID: NPC284948

Ingredient ID: NPC278625

Ingredient ID: NPC278434

Ingredient ID: NPC278102

Ingredient ID: NPC278069

Ingredient ID: NPC278068

Ingredient ID: NPC277878

Ingredient ID: NPC277730

Ingredient ID: NPC27699

Ingredient ID: NPC27657

Ingredient ID: NPC272471

Ingredient ID: NPC269980

Ingredient ID: NPC268799

Ingredient ID: NPC266159

Ingredient ID: NPC264227

Ingredient ID: NPC263983

Ingredient ID: NPC263325

Ingredient ID: NPC261831

Ingredient ID: NPC258079

Ingredient ID: NPC250121

Ingredient ID: NPC24831

Ingredient ID: NPC247726

Ingredient ID: NPC246117

Ingredient ID: NPC243728

Ingredient ID: NPC240455

Ingredient ID: NPC239564

Ingredient ID: NPC236709

Ingredient ID: NPC230301

Ingredient ID: NPC229893

Ingredient ID: NPC223736

Ingredient ID: NPC223099

Ingredient ID: NPC219913

Ingredient ID: NPC217162

Ingredient ID: NPC216630

Ingredient ID: NPC214858

Ingredient ID: NPC214687

Ingredient ID: NPC213262

Ingredient ID: NPC210040

Ingredient ID: NPC209970

Ingredient ID: NPC209560

Ingredient ID: NPC206800

Ingredient ID: NPC206095

Ingredient ID: NPC205727

Ingredient ID: NPC203719

Ingredient ID: NPC202551

Ingredient ID: NPC200608

Ingredient ID: NPC200184

Ingredient ID: NPC198888

Ingredient ID: NPC195749

Ingredient ID: NPC193351

Ingredient ID: NPC190337

Ingredient ID: NPC186849

Ingredient ID: NPC185743

Ingredient ID: NPC18480

Ingredient ID: NPC184049

Ingredient ID: NPC180787

Ingredient ID: NPC1786

Ingredient ID: NPC176214

Ingredient ID: NPC173385

Ingredient ID: NPC170035

Ingredient ID: NPC167976

Ingredient ID: NPC16728

Ingredient ID: NPC165798

Ingredient ID: NPC164540

Ingredient ID: NPC163105

Ingredient ID: NPC162282

Ingredient ID: NPC161414

Ingredient ID: NPC159362

Ingredient ID: NPC158088

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC15495

Ingredient ID: NPC154339

Ingredient ID: NPC153128

Ingredient ID: NPC149254

Ingredient ID: NPC149203

Ingredient ID: NPC149070

Ingredient ID: NPC148565

Ingredient ID: NPC147475

Ingredient ID: NPC144619

Ingredient ID: NPC144054

Ingredient ID: NPC143066

Ingredient ID: NPC138408

Ingredient ID: NPC13818

Ingredient ID: NPC136014

Ingredient ID: NPC135655

Ingredient ID: NPC128062

Ingredient ID: NPC127074

Ingredient ID: NPC122948

Ingredient ID: NPC122817

Ingredient ID: NPC12084

Ingredient ID: NPC12065

Ingredient ID: NPC120426

Ingredient ID: NPC116317

Ingredient ID: NPC115997

Ingredient ID: NPC115400

Ingredient ID: NPC114682

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC111888

Ingredient ID: NPC110699

Ingredient ID: NPC10866

Ingredient ID: NPC108047

Ingredient ID: NPC1075

Ingredient ID: NPC107482

Ingredient ID: NPC105817

Ingredient ID: NPC104743

Ingredient ID: NPC102177