• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Astragalus Membranaceus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

AGTCGATGCTTACTGCAGACCAACTAGTGAATCTGTTTGAATACTTAGGGATGGCTGGGGTGTTTTGCACCACGACCTCCCTTTGGGTGGGGGGTGGTGCGCAATGCGTTCCCCCTCCTGCCCGAACACAAACCCCGGCGCTCAATGCGCCAAGGAACTAAAATTCGATCAATGTGCCCCGTCGGCCCGGAGACGGTGCTTCGGCGGTGGTGCCTTGTCACATGATACAGAATGACTCTCGGCAACGGATATCTAGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGTTGAGGGCACGTCTGCCTGGGCGTCACATATCGTTGCCCGATGCCTATTGCAGTGTGATAGGAATTTTTAGGGCGAATGATGGCTTCCCGTGAGCGTTGTTGCCTCGCGGCTGGTTGAAAATTGAGTCCTTGGTGGGGTGTGCCATGATAGATGGTGGTCGAGTTAGCACGAGACCCATCATGTGTACGCTCCCCATAATATGGCTTCGATGACCCACATGCGTCTTTTGACTCTCATGACGAGACCTCAGGTCA

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO24846
Plant Latin Name: Astragalus Membranaceus
Taxonomy Genus: Astragalus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 649199
Plant-of-the-World-Online: 478611-1

Used in Medicines

Country/Region:
South Korea; China

Traditional Medicine System:
TCM; Kampo


Medicinal Functions:

Adaptogen; Antibacterial; Cancer; Cardiotonic; Diuretic; Febrifuge; Hypoglycaemic; Hypotensive; Pectoral; Tonic; Uterine tonic; Vasodilator

Geographical Distribution

South Africa; Mongolia; China; Japan; South Korea; Kazakhstan; Russia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

156 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


62 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

44 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97241

Ingredient ID: NPC89518

Ingredient ID: NPC89088

Ingredient ID: NPC87628

Ingredient ID: NPC8674

Ingredient ID: NPC85813

Ingredient ID: NPC80710

Ingredient ID: NPC80672

Ingredient ID: NPC75107

Ingredient ID: NPC66700

Ingredient ID: NPC61198

Ingredient ID: NPC61179

Ingredient ID: NPC54472

Ingredient ID: NPC51986

Ingredient ID: NPC50959

Ingredient ID: NPC50898

Ingredient ID: NPC49284

Ingredient ID: NPC480440

Ingredient ID: NPC47283

Ingredient ID: NPC47081

Ingredient ID: NPC46330

Ingredient ID: NPC45165

Ingredient ID: NPC423

Ingredient ID: NPC41117

Ingredient ID: NPC39064

Ingredient ID: NPC38877

Ingredient ID: NPC37871

Ingredient ID: NPC37769

Ingredient ID: NPC36408

Ingredient ID: NPC3617

Ingredient ID: NPC35543

Ingredient ID: NPC33987

Ingredient ID: NPC33240

Ingredient ID: NPC33117

Ingredient ID: NPC329542

Ingredient ID: NPC329079

Ingredient ID: NPC328407

Ingredient ID: NPC323537

Ingredient ID: NPC323434

Ingredient ID: NPC319817

Ingredient ID: NPC317651

Ingredient ID: NPC317556

Ingredient ID: NPC317439

Ingredient ID: NPC317145

Ingredient ID: NPC313851

Ingredient ID: NPC30769

Ingredient ID: NPC305741

Ingredient ID: NPC30096

Ingredient ID: NPC299763

Ingredient ID: NPC299335

Ingredient ID: NPC298895

Ingredient ID: NPC297669

Ingredient ID: NPC295697

Ingredient ID: NPC294412

Ingredient ID: NPC294409

Ingredient ID: NPC293875

Ingredient ID: NPC292340

Ingredient ID: NPC292204

Ingredient ID: NPC291428

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC287349

Ingredient ID: NPC285775

Ingredient ID: NPC279865

Ingredient ID: NPC270077

Ingredient ID: NPC267535

Ingredient ID: NPC265800

Ingredient ID: NPC258019

Ingredient ID: NPC254702

Ingredient ID: NPC250828

Ingredient ID: NPC249045

Ingredient ID: NPC246469

Ingredient ID: NPC243728

Ingredient ID: NPC242950

Ingredient ID: NPC239368

Ingredient ID: NPC236657

Ingredient ID: NPC236187

Ingredient ID: NPC234560

Ingredient ID: NPC230627

Ingredient ID: NPC230435

Ingredient ID: NPC230301

Ingredient ID: NPC230295

Ingredient ID: NPC229729

Ingredient ID: NPC229347

Ingredient ID: NPC228908

Ingredient ID: NPC228383

Ingredient ID: NPC225778

Ingredient ID: NPC225626

Ingredient ID: NPC222696

Ingredient ID: NPC221504

Ingredient ID: NPC221461

Ingredient ID: NPC22034

Ingredient ID: NPC218122

Ingredient ID: NPC216900

Ingredient ID: NPC216870

Ingredient ID: NPC213935

Ingredient ID: NPC212474

Ingredient ID: NPC209560

Ingredient ID: NPC208361

Ingredient ID: NPC207803

Ingredient ID: NPC207656

Ingredient ID: NPC206050

Ingredient ID: NPC20306

Ingredient ID: NPC202431

Ingredient ID: NPC198358

Ingredient ID: NPC194653

Ingredient ID: NPC193154

Ingredient ID: NPC19174

Ingredient ID: NPC186653

Ingredient ID: NPC184831

Ingredient ID: NPC184368

Ingredient ID: NPC183774

Ingredient ID: NPC18349

Ingredient ID: NPC181209

Ingredient ID: NPC179950

Ingredient ID: NPC176740

Ingredient ID: NPC16728

Ingredient ID: NPC162822

Ingredient ID: NPC156461

Ingredient ID: NPC15620

Ingredient ID: NPC152538

Ingredient ID: NPC146791

Ingredient ID: NPC146679

Ingredient ID: NPC145708

Ingredient ID: NPC143799

Ingredient ID: NPC143586

Ingredient ID: NPC142989

Ingredient ID: NPC142860

Ingredient ID: NPC142264

Ingredient ID: NPC141078

Ingredient ID: NPC14079

Ingredient ID: NPC137816

Ingredient ID: NPC136071

Ingredient ID: NPC13473

Ingredient ID: NPC133671

Ingredient ID: NPC131624

Ingredient ID: NPC130683

Ingredient ID: NPC130599

Ingredient ID: NPC126004

Ingredient ID: NPC125062

Ingredient ID: NPC123146

Ingredient ID: NPC1216

Ingredient ID: NPC121585

Ingredient ID: NPC121522

Ingredient ID: NPC117820

Ingredient ID: NPC116649

Ingredient ID: NPC1148

Ingredient ID: NPC114238

Ingredient ID: NPC11413

Ingredient ID: NPC111897

Ingredient ID: NPC111888

Ingredient ID: NPC111376

Ingredient ID: NPC109813

Ingredient ID: NPC108227

Ingredient ID: NPC106179

Ingredient ID: NPC105915