• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Sesamum Indicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

ACTGCGGAAGGATCATTGTCGAAACCTGCAGAGCAGACCGCGAACACGTTGCAAATAAAATCGGGGCCCGGGCGCGGGGCGAACGCCCCCGTCCGGTCCCCTCCCCCGCCGGCGCGCGCGAAAGCGCTCGACGTGCGGGCTAACGAACCCCCGGCGCGGCACGCGCCAAGGAAAACCGAACGAAKCGTCCGCCGCACGGTGGCCCCGTCCGCGGGGTGCACGGGCGGAGSGGACGTCTCTCGAATGTCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCCCGCCCATCGCGTGGGGGGCGGACATTGGCCTCCCGTGCGCATCCGCGCGCGGCCGGCCCAAATGNGATCCCGCGGCGACGCTTGTCACGACCAGTGGTGGTTGAACGCTCAACTCGCGTGCTGTCGTGCCGCGCTCGGCGTTGTTCGCTCGGGCATCACGTTGGACCCAAAGGCGCCAGCGCCTCCGACCGCGACCCCAGGTCAGGCGGGATCACCCG

Click for details-----ITS1

ACTGCGGAAGGATCATTGTCGAAACCTGCAGAGCAGACCGCGAACACGTTGCAAATAAAATCGGGGCCCGGGCGCGGGGCGAACGCCCCCGTCCGGTCCCCTCCCCCGCCGGCGCGCGCGAAAGCGCTCGACGTGCGGGCTAACGAACCCCCGGCGCGGCACGCGCCAAGGAAAACCGAACGAAKCGTCCGCCGCACGGTGGCCCCGTCCGCGGGGTGCACGGGCGGAGSGGACGTCTCTCGAATGTCAAAA

Click for details-----ITS2

ATCGCGTCGCCCCCCCCGCCCATCGCGTGGGGGGCGGACATTGGCCTCCCGTGCGCATCCGCGCGCGGCCGGCCCAAATGNGATCCCGCGGCGACGCTTGTCACGACCAGTGGTGGTTGAACGCTCAACTCGCGTGCTGTCGTGCCGCGCTCGGCGTTGTTCGCTCGGGCATCACGTTGGACCCAAAGGCGCCAGCGCCTCCGACCGCGACCCCAGGTCAGGCGGGATCACCCG
Taxonomic Information

Plant ID: NPO24778
Plant Latin Name: Sesamum Indicum
Taxonomy Genus: Sesamum
Taxonomy Family: Pedaliaceae

Plant External Links:

NCBI TaxonomyDB: 4182
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
China; Philippines; India

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; Kampo; TCM


Medicinal Functions:

Astringent; Diuretic; Emollient; Galactogogue; Lenitive; Nutritive; Skin; Tonic

Geographical Distribution

India; Philippines; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

184 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


124 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

96 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC87125

Ingredient ID: NPC85813

Ingredient ID: NPC78568

Ingredient ID: NPC77272

Ingredient ID: NPC75107

Ingredient ID: NPC73143

Ingredient ID: NPC70744

Ingredient ID: NPC69539

Ingredient ID: NPC65966

Ingredient ID: NPC63756

Ingredient ID: NPC62045

Ingredient ID: NPC60548

Ingredient ID: NPC60151

Ingredient ID: NPC59906

Ingredient ID: NPC59650

Ingredient ID: NPC55412

Ingredient ID: NPC490427

Ingredient ID: NPC490424

Ingredient ID: NPC490391

Ingredient ID: NPC490321

Ingredient ID: NPC490306

Ingredient ID: NPC490298

Ingredient ID: NPC490294

Ingredient ID: NPC490289

Ingredient ID: NPC490288

Ingredient ID: NPC490287

Ingredient ID: NPC490286

Ingredient ID: NPC490082

Ingredient ID: NPC489915

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC489899

Ingredient ID: NPC489887

Ingredient ID: NPC489882

Ingredient ID: NPC48623

Ingredient ID: NPC461221

Ingredient ID: NPC45663

Ingredient ID: NPC45638

Ingredient ID: NPC45249

Ingredient ID: NPC43885

Ingredient ID: NPC43246

Ingredient ID: NPC424

Ingredient ID: NPC42372

Ingredient ID: NPC41117

Ingredient ID: NPC40432

Ingredient ID: NPC36061

Ingredient ID: NPC33611

Ingredient ID: NPC331670

Ingredient ID: NPC331178

Ingredient ID: NPC3295

Ingredient ID: NPC328447

Ingredient ID: NPC325839

Ingredient ID: NPC322812

Ingredient ID: NPC320323

Ingredient ID: NPC317120

Ingredient ID: NPC313955

Ingredient ID: NPC311057

Ingredient ID: NPC309606

Ingredient ID: NPC307050

Ingredient ID: NPC30447

Ingredient ID: NPC303181

Ingredient ID: NPC302716

Ingredient ID: NPC299969

Ingredient ID: NPC295644

Ingredient ID: NPC294548

Ingredient ID: NPC290613

Ingredient ID: NPC290319

Ingredient ID: NPC29

Ingredient ID: NPC281972

Ingredient ID: NPC281686

Ingredient ID: NPC280749

Ingredient ID: NPC280257

Ingredient ID: NPC278434

Ingredient ID: NPC278072

Ingredient ID: NPC274613

Ingredient ID: NPC273769

Ingredient ID: NPC272614

Ingredient ID: NPC270699

Ingredient ID: NPC269980

Ingredient ID: NPC269919

Ingredient ID: NPC262475

Ingredient ID: NPC261831

Ingredient ID: NPC257582

Ingredient ID: NPC256849

Ingredient ID: NPC247871

Ingredient ID: NPC246358

Ingredient ID: NPC245852

Ingredient ID: NPC245085

Ingredient ID: NPC242580

Ingredient ID: NPC23962

Ingredient ID: NPC237812

Ingredient ID: NPC236227

Ingredient ID: NPC23549

Ingredient ID: NPC235260

Ingredient ID: NPC230301

Ingredient ID: NPC228908

Ingredient ID: NPC228346

Ingredient ID: NPC228180

Ingredient ID: NPC226453

Ingredient ID: NPC226027

Ingredient ID: NPC222696

Ingredient ID: NPC221733

Ingredient ID: NPC219769

Ingredient ID: NPC219576

Ingredient ID: NPC219143

Ingredient ID: NPC213876

Ingredient ID: NPC208793

Ingredient ID: NPC207561

Ingredient ID: NPC203719

Ingredient ID: NPC203468

Ingredient ID: NPC199072

Ingredient ID: NPC197316

Ingredient ID: NPC190623

Ingredient ID: NPC189436

Ingredient ID: NPC187998

Ingredient ID: NPC187993

Ingredient ID: NPC185755

Ingredient ID: NPC185189

Ingredient ID: NPC17810

Ingredient ID: NPC176814

Ingredient ID: NPC174246

Ingredient ID: NPC171928

Ingredient ID: NPC171139

Ingredient ID: NPC168707

Ingredient ID: NPC16830

Ingredient ID: NPC1682

Ingredient ID: NPC167400

Ingredient ID: NPC162742

Ingredient ID: NPC162713

Ingredient ID: NPC162693

Ingredient ID: NPC162313

Ingredient ID: NPC161557

Ingredient ID: NPC160850

Ingredient ID: NPC159418

Ingredient ID: NPC158079

Ingredient ID: NPC156461

Ingredient ID: NPC156298

Ingredient ID: NPC155763

Ingredient ID: NPC154172

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC148825

Ingredient ID: NPC147983

Ingredient ID: NPC146197

Ingredient ID: NPC141765

Ingredient ID: NPC139114

Ingredient ID: NPC139047

Ingredient ID: NPC138848

Ingredient ID: NPC137958

Ingredient ID: NPC137537

Ingredient ID: NPC136014

Ingredient ID: NPC135974

Ingredient ID: NPC13483

Ingredient ID: NPC134405

Ingredient ID: NPC133123

Ingredient ID: NPC132540

Ingredient ID: NPC132177

Ingredient ID: NPC130683

Ingredient ID: NPC129707

Ingredient ID: NPC128410

Ingredient ID: NPC126759

Ingredient ID: NPC126681

Ingredient ID: NPC126409

Ingredient ID: NPC125191

Ingredient ID: NPC123526

Ingredient ID: NPC120649

Ingredient ID: NPC120635

Ingredient ID: NPC116961

Ingredient ID: NPC115723

Ingredient ID: NPC115207

Ingredient ID: NPC114924

Ingredient ID: NPC11433

Ingredient ID: NPC114325

Ingredient ID: NPC113877

Ingredient ID: NPC113733

Ingredient ID: NPC113212

Ingredient ID: NPC112890

Ingredient ID: NPC111888

Ingredient ID: NPC107588

Ingredient ID: NPC106486

Ingredient ID: NPC101153

Ingredient ID: NPC100223