• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Angelica Dahurica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCCGAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTAAAAATTTAGGCGAGCGTCGGGAGGCCTCGGTCTCCTGTTTGCGAATCCATGGTAGGTGGCCACTCCCGGGTGGCCACTGGCCTACAAAATCATTCGGGCGCGGTATGCGCCAAGGACCTTAAAATCGAATTGTACGTCCGTATCCCGTTAGCGGGCATCGGCGTCTTTCCAAAATACAACGACTCTCGACAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACTTGGCTGAGGGCACGCCTGCCTGGGTGTCACGCATTGTATTGCCCACAAACCAGTCACACCTGAGAAGTTGTGCCGGTTTGGGGCGGAAATTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAATGAGTCTCCGGCGATGGACGTCGCGACATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGTGAATCCTCGTCATCTTAGAGAGCTCCAGGACCCTTAGGCAGCACGTACTCTGTGCGCTTCGA

Click for details-----ITS1

TCCGAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTGCAATAGCAGAATGACCCGCTAACACGTAAAAATTTAGGCGAGCGTCGGGAGGCCTCGGTCTCCTGTTTGCGAATCCATGGTAGGTGGCCACTCCCGGGTGGCCACTGGCCTACAAAATCATTCGGGCGCGGTATGCGCCAAGGACCTTAAAATCGAATTGTACGTCCGTATCCCGTTAGCGGGCATCGGCGTCTTTCCAAAATACAA

Click for details-----ITS2

ATTGTATTGCCCACAAACCAGTCACACCTGAGAAGTTGTGCCGGTTTGGGGCGGAAATTGGCCTCCCGTACCTTGTCGTGCGGTTGGCGGAAAAATGAGTCTCCGGCGATGGACGTCGCGACATCGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGCGTGAATCCTCGTCATCTTAGAGAGCTCCAGGACCCTTAGGCAGCACGTACTCTGTGCGCTTCGACTGTGACCCCAGGTCAGGCGGGACT
Taxonomic Information

Plant ID: NPO24758
Plant Latin Name: Angelica Dahurica
Taxonomy Genus: Angelica
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 48101
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
South Korea

Traditional Medicine System:
Kampo


Medicinal Functions:

Analgesic; Antibacterial; Antidote; Carminative; Diaphoretic; Poultice; Stimulant

Geographical Distribution

South Korea

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

238 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


214 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

112 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98179

Ingredient ID: NPC96294

Ingredient ID: NPC96286

Ingredient ID: NPC95995

Ingredient ID: NPC95472

Ingredient ID: NPC93219

Ingredient ID: NPC93076

Ingredient ID: NPC91226

Ingredient ID: NPC89956

Ingredient ID: NPC89591

Ingredient ID: NPC88566

Ingredient ID: NPC88445

Ingredient ID: NPC87029

Ingredient ID: NPC83421

Ingredient ID: NPC79993

Ingredient ID: NPC79270

Ingredient ID: NPC78659

Ingredient ID: NPC78612

Ingredient ID: NPC78551

Ingredient ID: NPC78094

Ingredient ID: NPC77572

Ingredient ID: NPC76976

Ingredient ID: NPC76336

Ingredient ID: NPC74765

Ingredient ID: NPC74539

Ingredient ID: NPC72178

Ingredient ID: NPC71544

Ingredient ID: NPC70546

Ingredient ID: NPC68153

Ingredient ID: NPC67978

Ingredient ID: NPC67450

Ingredient ID: NPC66577

Ingredient ID: NPC65913

Ingredient ID: NPC63697

Ingredient ID: NPC63355

Ingredient ID: NPC61828

Ingredient ID: NPC61

Ingredient ID: NPC60175

Ingredient ID: NPC54379

Ingredient ID: NPC53069

Ingredient ID: NPC51404

Ingredient ID: NPC51146

Ingredient ID: NPC48053

Ingredient ID: NPC478570

Ingredient ID: NPC478569

Ingredient ID: NPC478568

Ingredient ID: NPC478567

Ingredient ID: NPC478566

Ingredient ID: NPC478565

Ingredient ID: NPC478564

Ingredient ID: NPC47596

Ingredient ID: NPC47354

Ingredient ID: NPC47272

Ingredient ID: NPC46744

Ingredient ID: NPC46451

Ingredient ID: NPC45727

Ingredient ID: NPC43728

Ingredient ID: NPC43428

Ingredient ID: NPC36408

Ingredient ID: NPC33320

Ingredient ID: NPC329547

Ingredient ID: NPC32909

Ingredient ID: NPC328211

Ingredient ID: NPC326093

Ingredient ID: NPC326

Ingredient ID: NPC323755

Ingredient ID: NPC321965

Ingredient ID: NPC319323

Ingredient ID: NPC316333

Ingredient ID: NPC31311

Ingredient ID: NPC312869

Ingredient ID: NPC312132

Ingredient ID: NPC31194

Ingredient ID: NPC311000

Ingredient ID: NPC309671

Ingredient ID: NPC308267

Ingredient ID: NPC305208

Ingredient ID: NPC303210

Ingredient ID: NPC302642

Ingredient ID: NPC301549

Ingredient ID: NPC301410

Ingredient ID: NPC300476

Ingredient ID: NPC300141

Ingredient ID: NPC298104

Ingredient ID: NPC296377

Ingredient ID: NPC296337

Ingredient ID: NPC295849

Ingredient ID: NPC295608

Ingredient ID: NPC292869

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC289841

Ingredient ID: NPC289785

Ingredient ID: NPC289143

Ingredient ID: NPC288932

Ingredient ID: NPC287754

Ingredient ID: NPC285852

Ingredient ID: NPC283790

Ingredient ID: NPC282420

Ingredient ID: NPC281835

Ingredient ID: NPC278310

Ingredient ID: NPC278289

Ingredient ID: NPC278010

Ingredient ID: NPC276761

Ingredient ID: NPC275856

Ingredient ID: NPC275687

Ingredient ID: NPC273832

Ingredient ID: NPC273607

Ingredient ID: NPC272965

Ingredient ID: NPC272016

Ingredient ID: NPC269680

Ingredient ID: NPC268862

Ingredient ID: NPC268334

Ingredient ID: NPC267801

Ingredient ID: NPC266596

Ingredient ID: NPC266144

Ingredient ID: NPC261094

Ingredient ID: NPC253574

Ingredient ID: NPC253526

Ingredient ID: NPC250769

Ingredient ID: NPC250028

Ingredient ID: NPC248884

Ingredient ID: NPC248429

Ingredient ID: NPC247927

Ingredient ID: NPC247553

Ingredient ID: NPC246903

Ingredient ID: NPC244495

Ingredient ID: NPC243546

Ingredient ID: NPC243509

Ingredient ID: NPC240722

Ingredient ID: NPC239270

Ingredient ID: NPC23736

Ingredient ID: NPC234536

Ingredient ID: NPC233538

Ingredient ID: NPC231738

Ingredient ID: NPC2314

Ingredient ID: NPC230301

Ingredient ID: NPC229786

Ingredient ID: NPC227986

Ingredient ID: NPC226250

Ingredient ID: NPC224165

Ingredient ID: NPC223249

Ingredient ID: NPC222001

Ingredient ID: NPC221754

Ingredient ID: NPC219104

Ingredient ID: NPC218484

Ingredient ID: NPC216630

Ingredient ID: NPC216459

Ingredient ID: NPC216092

Ingredient ID: NPC215722

Ingredient ID: NPC210460

Ingredient ID: NPC207757

Ingredient ID: NPC206264

Ingredient ID: NPC203924

Ingredient ID: NPC201622

Ingredient ID: NPC200026

Ingredient ID: NPC198876

Ingredient ID: NPC19756

Ingredient ID: NPC194691

Ingredient ID: NPC193881

Ingredient ID: NPC193039

Ingredient ID: NPC191104

Ingredient ID: NPC190970

Ingredient ID: NPC190810

Ingredient ID: NPC190588

Ingredient ID: NPC187609

Ingredient ID: NPC187145

Ingredient ID: NPC186653

Ingredient ID: NPC186098

Ingredient ID: NPC185041

Ingredient ID: NPC182076

Ingredient ID: NPC181770

Ingredient ID: NPC180832

Ingredient ID: NPC180534

Ingredient ID: NPC179524

Ingredient ID: NPC179037

Ingredient ID: NPC177581

Ingredient ID: NPC177112

Ingredient ID: NPC176819

Ingredient ID: NPC176383

Ingredient ID: NPC173228

Ingredient ID: NPC173149

Ingredient ID: NPC17216

Ingredient ID: NPC171409

Ingredient ID: NPC170044

Ingredient ID: NPC169

Ingredient ID: NPC168435

Ingredient ID: NPC167863

Ingredient ID: NPC163984

Ingredient ID: NPC163533

Ingredient ID: NPC161206

Ingredient ID: NPC159728

Ingredient ID: NPC158916

Ingredient ID: NPC15819

Ingredient ID: NPC157192

Ingredient ID: NPC156461

Ingredient ID: NPC155882

Ingredient ID: NPC155264

Ingredient ID: NPC152178

Ingredient ID: NPC149042

Ingredient ID: NPC147990

Ingredient ID: NPC144288

Ingredient ID: NPC144023

Ingredient ID: NPC142753

Ingredient ID: NPC141777

Ingredient ID: NPC139891

Ingredient ID: NPC139131

Ingredient ID: NPC138487

Ingredient ID: NPC138113

Ingredient ID: NPC137949

Ingredient ID: NPC137177

Ingredient ID: NPC137115

Ingredient ID: NPC136244

Ingredient ID: NPC131725

Ingredient ID: NPC131204

Ingredient ID: NPC130658

Ingredient ID: NPC128063

Ingredient ID: NPC127091

Ingredient ID: NPC126240

Ingredient ID: NPC124226

Ingredient ID: NPC122962

Ingredient ID: NPC117411

Ingredient ID: NPC116895

Ingredient ID: NPC116062

Ingredient ID: NPC116027

Ingredient ID: NPC114239

Ingredient ID: NPC114011

Ingredient ID: NPC113928

Ingredient ID: NPC11263

Ingredient ID: NPC110895

Ingredient ID: NPC108218

Ingredient ID: NPC107244

Ingredient ID: NPC105246

Ingredient ID: NPC104893

Ingredient ID: NPC103671

Ingredient ID: NPC10251

Ingredient ID: NPC100773

Ingredient ID: NPC100079