• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Meryta Denhamii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TGCACAGCAGAACGACCCGCGAACACGTTACAACACCGGGTAAGGGACGAAGGGTGCGCAAGCTCCCCAAGTCGCGAACCCATGGTCGGGGACTGCCTTCGGGTGTTTCCTCGTCCGAACAACGACCCCCCGGCGCGGAATGCGCCAAGGAAATCAAACTGAACTGCACGCGTCCCCCCGTTCGCGGGCGACGGAGGCGTCTTTCTAAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAACCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCAACCCTGCGCTCCCTCATAGGAGCCGAGGCGGAGGGGCGGATACTGGCCTCCCGTGTCTCACCGTGCGGCTGGCCCAAATGTGAGTCCTTGGCGACGGACGTCACGACAAGTGGTGGTTGTAAAAGGCCCTCTTCTCCTGTCGTGTAACGACCCGTCGCCAGCGAAAGCTCCCGTGACCCTGTTGCGCCGTCCTTGACGCGCGCTCCGACCGCGACCCCAGGTCAGGC

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGCGTCGCCCCCCAACCCTGCGCTCCCTCATAGGAGCCGAGGCGGAGGGGCGGATACTGGCCTCCCGTGTCTCACCGTGCGGCTGGCCCAAATGTGAGTCCTTGGCGACGGACGTCACGACAAGTGGTGGTTGTAAAAGGCCCTCTTCTCCTGTCGTGTAACGACCCGTCGCCAGCGAAAGCTCCCGTGACCCTGTTGCGCCGTCCTTGACGCGCGCTCCGACCGCGACCCCAGGTCAGGC
Taxonomic Information

Plant ID: NPO24757
Plant Latin Name: Meryta Denhamii
Taxonomy Genus: Meryta
Taxonomy Family: Araliaceae

Plant External Links:

NCBI TaxonomyDB: 126688
Plant-of-the-World-Online: 91016-1

Used in Medicines

Unknown.

Geographical Distribution

New Caledonia

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

86 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

15 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC96806

Ingredient ID: NPC92474

Ingredient ID: NPC79788

Ingredient ID: NPC77296

Ingredient ID: NPC7642

Ingredient ID: NPC75028

Ingredient ID: NPC72022

Ingredient ID: NPC70204

Ingredient ID: NPC6828

Ingredient ID: NPC66995

Ingredient ID: NPC66667

Ingredient ID: NPC64715

Ingredient ID: NPC64360

Ingredient ID: NPC64242

Ingredient ID: NPC55920

Ingredient ID: NPC50713

Ingredient ID: NPC476068

Ingredient ID: NPC475516

Ingredient ID: NPC475514

Ingredient ID: NPC475467

Ingredient ID: NPC475160

Ingredient ID: NPC45428

Ingredient ID: NPC4311

Ingredient ID: NPC40187

Ingredient ID: NPC36565

Ingredient ID: NPC33867

Ingredient ID: NPC307063

Ingredient ID: NPC281471

Ingredient ID: NPC280582

Ingredient ID: NPC274420

Ingredient ID: NPC271585

Ingredient ID: NPC270249

Ingredient ID: NPC269532

Ingredient ID: NPC267753

Ingredient ID: NPC26741

Ingredient ID: NPC260833

Ingredient ID: NPC259162

Ingredient ID: NPC258617

Ingredient ID: NPC249288

Ingredient ID: NPC248889

Ingredient ID: NPC248500

Ingredient ID: NPC243728

Ingredient ID: NPC241720

Ingredient ID: NPC241199

Ingredient ID: NPC238532

Ingredient ID: NPC228892

Ingredient ID: NPC226723

Ingredient ID: NPC224999

Ingredient ID: NPC216358

Ingredient ID: NPC216257

Ingredient ID: NPC206264

Ingredient ID: NPC202229

Ingredient ID: NPC199837

Ingredient ID: NPC195232

Ingredient ID: NPC192074

Ingredient ID: NPC19101

Ingredient ID: NPC186806

Ingredient ID: NPC182466

Ingredient ID: NPC177818

Ingredient ID: NPC17743

Ingredient ID: NPC174668

Ingredient ID: NPC172282

Ingredient ID: NPC171615

Ingredient ID: NPC164957

Ingredient ID: NPC154738

Ingredient ID: NPC153870

Ingredient ID: NPC15378

Ingredient ID: NPC153588

Ingredient ID: NPC151968

Ingredient ID: NPC148965

Ingredient ID: NPC147335

Ingredient ID: NPC143227

Ingredient ID: NPC141136

Ingredient ID: NPC140777

Ingredient ID: NPC133948

Ingredient ID: NPC130382

Ingredient ID: NPC128986

Ingredient ID: NPC128225

Ingredient ID: NPC125892

Ingredient ID: NPC125072

Ingredient ID: NPC121797

Ingredient ID: NPC114928

Ingredient ID: NPC114687

Ingredient ID: NPC112274

Ingredient ID: NPC111607

Ingredient ID: NPC100684