• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Abutilon Indicum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

CATTGTCGAACCTGCCTAGCAGAATGACCCGTGAATGTGTTATCATACAAAACACCGAGAGGGTGCGGATGCAATATTGCCCCAACCCCTCTCGATGCATTGGTGTGTTTGGTCTTGCCTCAGCCCACCTCGTGAGGGAGAGTTGCAAGTGCCATGCACTCCAAGGCAAAACCAACAACCCCCGGCGCGAATTGCGCCAAGGAATTTAAATGAAAAGAGTGCACGTTACTGTCGCCGACCCGTTCGCGGTGTTTGGGCGAGAGTTTCGCTGTTACTTTTGTCGTGAAAATACAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCACGTCGCCCACGTCACACATCCTTTCTTGGATCGTGTATTACGTGGGCGGATACTGGTCTCCCGTGCCCATGGTGTGGTTGGCCCAAACACGAGTCCGCTAAAGAAAGAGGCACGACTGGTGGTGGTTTGATTTCACAGTCGTCTTGGTCGTGTGCTCTGACTCTTAAAGCGAAATGACTTAAAATTGCCATGATGTGTTGTTCTTGTGACGGCCTTTCGA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTCGCCCCCATCAAACCTCGAGCTTWTTTCAGCTCAGGGCAATTTGAGGGCGGAAAWTGGCTTCCCGTGCGCTCACCGCCTGCGGTTGGCCTAAATAATAGTCTTCGGCGATGAAGTGCCGCGACAATCGGTGGGAATGCTTTTGGCTGTCTCGTTCGAAGTCGTGTRCGATCGTCGGTTTGGACCCTATGACCCTTTTGGCATCACAATGATGGTGCTTGCA
Taxonomic Information

Plant ID: NPO24749
Plant Latin Name: Abutilon Indicum
Taxonomy Genus: Abutilon
Taxonomy Family: Malvaceae

Plant External Links:

NCBI TaxonomyDB: 318060
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Philippines; Indonesia; India; Malaysia; China; Thailand

Traditional Medicine System:
Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM

Geographical Distribution

Philippines; Indonesia; India; Malaysia; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


6 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94269

Ingredient ID: NPC86412

Ingredient ID: NPC56698

Ingredient ID: NPC34241

Ingredient ID: NPC28187

Ingredient ID: NPC2634

Ingredient ID: NPC230301

Ingredient ID: NPC217640

Ingredient ID: NPC213001

Ingredient ID: NPC192638

Ingredient ID: NPC181197

Ingredient ID: NPC139539

Ingredient ID: NPC12774

Ingredient ID: NPC118897