• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Hansenia Forbesii


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATTCCTGCAATAGCAGAATGACCCGCTAACATGTAAACACACCGGGCCAGTGTCGGGGGGCTTCAGTCCCTCGTTTGCGAACCCAAGGACGGTGGGCGCTCTCGGGTGCCCACCGGCCGATGAAACCAACCGGGCGCGGTATGCGCCAAGTAAATCAAAACTGAATTGTACGTCTGCTTCCTGTCCGTGGGAAGAGGCGTCTTTTTGAAACACAAACGACTCTCGGCAACGGATATCCCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGACGCCACTAGGTTGAGGGCACGCCTGCCTGGGTGTCACGCATCGTGTTGCCCCTGACCACTCTCTCCTCGAGGAGATGAGCCGGGCTGGGGGCGGATATTGGCCTCCCGTGCCTTGCGGCGCTGCTGGCCCAAAAGCGAGTCTCTGGCGACGGACGTCGTGACATTTGTGGTTGTAAAAAGACCCTATTCTTTTGTCGCACGAATACCCGTCACCTAAGCGAGCTCGATGACCCTTCTGCGCCACAAATCGTGTGCGCTCGACTG

Click for details-----ITS1

TCGATTCCTGCAATAGCAGAATGACCCGCTAACATGTAAACACACCGGGCCAGTGTCGGGGGGCTTCAGTCCCTCGTTTGCGAACCCCAGGACGGTAGGCGCTCTCGGGTGCCCACCGGCCGATGAAACCAACCGGGCGCGGTATGCGCCAAGCAAATCAAAACTGAATTGTACGTCTGCTTCCTGTCCGTGGGAAGAGGCGTATTTTCGAAACACAAA

Click for details-----ITS2

ATCGTGTTGCCCCTGACCACTCTCTCCTCGAGGAGATGAGCCGGGCTGGGGGCGGATATTGGCCTCCCGTGCCTTGCGGCGCTGCTGGCCCAAAAGCGAGTCTCTGGCGACGGACGTCGTGACATTTGTGGTTGTAAAAAGACCCTATTCTTTTGTCGCACGAATACCCGTCACCTAAGCGAGCTCGATGACCCTTCTGCGCCACAAATCGTGTGCGCTCGACTG
Taxonomic Information

Plant ID: NPO24644
Plant Latin Name: Hansenia Forbesii
Taxonomy Genus: Hansenia
Taxonomy Family: Apiaceae

Plant External Links:

NCBI TaxonomyDB: 165499
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

248 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


213 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

125 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC98925

Ingredient ID: NPC9880

Ingredient ID: NPC96630

Ingredient ID: NPC96218

Ingredient ID: NPC95663

Ingredient ID: NPC94901

Ingredient ID: NPC92592

Ingredient ID: NPC91962

Ingredient ID: NPC91226

Ingredient ID: NPC89069

Ingredient ID: NPC88566

Ingredient ID: NPC88445

Ingredient ID: NPC87564

Ingredient ID: NPC85813

Ingredient ID: NPC84807

Ingredient ID: NPC82843

Ingredient ID: NPC81010

Ingredient ID: NPC78551

Ingredient ID: NPC78094

Ingredient ID: NPC77989

Ingredient ID: NPC77272

Ingredient ID: NPC76336

Ingredient ID: NPC76145

Ingredient ID: NPC75158

Ingredient ID: NPC74539

Ingredient ID: NPC73494

Ingredient ID: NPC71703

Ingredient ID: NPC71506

Ingredient ID: NPC70744

Ingredient ID: NPC70012

Ingredient ID: NPC67936

Ingredient ID: NPC67920

Ingredient ID: NPC67450

Ingredient ID: NPC66577

Ingredient ID: NPC65873

Ingredient ID: NPC64357

Ingredient ID: NPC63697

Ingredient ID: NPC63355

Ingredient ID: NPC61769

Ingredient ID: NPC56112

Ingredient ID: NPC5326

Ingredient ID: NPC52961

Ingredient ID: NPC52005

Ingredient ID: NPC51329

Ingredient ID: NPC51189

Ingredient ID: NPC49151

Ingredient ID: NPC4818

Ingredient ID: NPC47970

Ingredient ID: NPC46587

Ingredient ID: NPC45727

Ingredient ID: NPC44751

Ingredient ID: NPC43114

Ingredient ID: NPC42471

Ingredient ID: NPC424

Ingredient ID: NPC4178

Ingredient ID: NPC37132

Ingredient ID: NPC36881

Ingredient ID: NPC3649

Ingredient ID: NPC34764

Ingredient ID: NPC34589

Ingredient ID: NPC33986

Ingredient ID: NPC33886

Ingredient ID: NPC33489

Ingredient ID: NPC32279

Ingredient ID: NPC32021

Ingredient ID: NPC31194

Ingredient ID: NPC310373

Ingredient ID: NPC308218

Ingredient ID: NPC305078

Ingredient ID: NPC303870

Ingredient ID: NPC303210

Ingredient ID: NPC30286

Ingredient ID: NPC301696

Ingredient ID: NPC301585

Ingredient ID: NPC300649

Ingredient ID: NPC30025

Ingredient ID: NPC297643

Ingredient ID: NPC296377

Ingredient ID: NPC296337

Ingredient ID: NPC296115

Ingredient ID: NPC29561

Ingredient ID: NPC295608

Ingredient ID: NPC291233

Ingredient ID: NPC290905

Ingredient ID: NPC290621

Ingredient ID: NPC290613

Ingredient ID: NPC290319

Ingredient ID: NPC290189

Ingredient ID: NPC29

Ingredient ID: NPC289785

Ingredient ID: NPC288651

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC282059

Ingredient ID: NPC279508

Ingredient ID: NPC279300

Ingredient ID: NPC279026

Ingredient ID: NPC278711

Ingredient ID: NPC278010

Ingredient ID: NPC273054

Ingredient ID: NPC27184

Ingredient ID: NPC270044

Ingredient ID: NPC269495

Ingredient ID: NPC26906

Ingredient ID: NPC268862

Ingredient ID: NPC268221

Ingredient ID: NPC268130

Ingredient ID: NPC261831

Ingredient ID: NPC261080

Ingredient ID: NPC260381

Ingredient ID: NPC2596

Ingredient ID: NPC256848

Ingredient ID: NPC253757

Ingredient ID: NPC253574

Ingredient ID: NPC2518

Ingredient ID: NPC250769

Ingredient ID: NPC250630

Ingredient ID: NPC248884

Ingredient ID: NPC248411

Ingredient ID: NPC247553

Ingredient ID: NPC246165

Ingredient ID: NPC245735

Ingredient ID: NPC243546

Ingredient ID: NPC243509

Ingredient ID: NPC24327

Ingredient ID: NPC241721

Ingredient ID: NPC240899

Ingredient ID: NPC240050

Ingredient ID: NPC239270

Ingredient ID: NPC237010

Ingredient ID: NPC236566

Ingredient ID: NPC236119

Ingredient ID: NPC233376

Ingredient ID: NPC233209

Ingredient ID: NPC232375

Ingredient ID: NPC231738

Ingredient ID: NPC230301

Ingredient ID: NPC230221

Ingredient ID: NPC229309

Ingredient ID: NPC227670

Ingredient ID: NPC223697

Ingredient ID: NPC22338

Ingredient ID: NPC222997

Ingredient ID: NPC222001

Ingredient ID: NPC221758

Ingredient ID: NPC219104

Ingredient ID: NPC218918

Ingredient ID: NPC216630

Ingredient ID: NPC215632

Ingredient ID: NPC215179

Ingredient ID: NPC214909

Ingredient ID: NPC214584

Ingredient ID: NPC213935

Ingredient ID: NPC213903

Ingredient ID: NPC213749

Ingredient ID: NPC210460

Ingredient ID: NPC209970

Ingredient ID: NPC208936

Ingredient ID: NPC208764

Ingredient ID: NPC204885

Ingredient ID: NPC202189

Ingredient ID: NPC201844

Ingredient ID: NPC201581

Ingredient ID: NPC201215

Ingredient ID: NPC200258

Ingredient ID: NPC196924

Ingredient ID: NPC196490

Ingredient ID: NPC194774

Ingredient ID: NPC194562

Ingredient ID: NPC194258

Ingredient ID: NPC193258

Ingredient ID: NPC19319

Ingredient ID: NPC193180

Ingredient ID: NPC192962

Ingredient ID: NPC191104

Ingredient ID: NPC190810

Ingredient ID: NPC19047

Ingredient ID: NPC189036

Ingredient ID: NPC187145

Ingredient ID: NPC182943

Ingredient ID: NPC181016

Ingredient ID: NPC180684

Ingredient ID: NPC179831

Ingredient ID: NPC178223

Ingredient ID: NPC177112

Ingredient ID: NPC175342

Ingredient ID: NPC174368

Ingredient ID: NPC173996

Ingredient ID: NPC173691

Ingredient ID: NPC171736

Ingredient ID: NPC16728

Ingredient ID: NPC166894

Ingredient ID: NPC166710

Ingredient ID: NPC166362

Ingredient ID: NPC165967

Ingredient ID: NPC165525

Ingredient ID: NPC164204

Ingredient ID: NPC163984

Ingredient ID: NPC163533

Ingredient ID: NPC16070

Ingredient ID: NPC160416

Ingredient ID: NPC159087

Ingredient ID: NPC156768

Ingredient ID: NPC156155

Ingredient ID: NPC155882

Ingredient ID: NPC155263

Ingredient ID: NPC154186

Ingredient ID: NPC15074

Ingredient ID: NPC150713

Ingredient ID: NPC149184

Ingredient ID: NPC147957

Ingredient ID: NPC147723

Ingredient ID: NPC14682

Ingredient ID: NPC146522

Ingredient ID: NPC146197

Ingredient ID: NPC145053

Ingredient ID: NPC144891

Ingredient ID: NPC142871

Ingredient ID: NPC14227

Ingredient ID: NPC141777

Ingredient ID: NPC13991

Ingredient ID: NPC139891

Ingredient ID: NPC139588

Ingredient ID: NPC138113

Ingredient ID: NPC137949

Ingredient ID: NPC137115

Ingredient ID: NPC135238

Ingredient ID: NPC132565

Ingredient ID: NPC131725

Ingredient ID: NPC131431

Ingredient ID: NPC130683

Ingredient ID: NPC130658

Ingredient ID: NPC130254

Ingredient ID: NPC12664

Ingredient ID: NPC125935

Ingredient ID: NPC124093

Ingredient ID: NPC121373

Ingredient ID: NPC120926

Ingredient ID: NPC120867

Ingredient ID: NPC120225

Ingredient ID: NPC114784

Ingredient ID: NPC114239

Ingredient ID: NPC113928

Ingredient ID: NPC113122

Ingredient ID: NPC109093

Ingredient ID: NPC107540

Ingredient ID: NPC104569

Ingredient ID: NPC100842