CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Stevia Origanoides

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAATCCTGCATAGCAGAACAACCCGTGAACACGTAACAACAAAAAATGGTTTCGTGAGGATTGATGCTTTTTTGTTTCGGTCCTTGTGAAGCCTACGTCGACGTATGTCCTATGGTTTCCTTGTTTGGGCACCTATGGACATCATGTTGTCGCAACAACCACCCCCGGCACAACATGTGCCAAGGAATACTAAACTTAGGAGTTCCCATGCTGTGATCCCCCGTATGTGGTGTGTTCAATGTATGTGGCTTCTTTCAAACACAAAACGACTCTCGGCAACGGATATCTCGGCTCACNNNNNNNNNNNNNNNNNNNNAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCAAAGCCATCTGGTTGAGGGCACGTCTGCCTGGGCGTCACGTGTCACGTTGCCTGCATCGAACCTCTGTTATCGTGGTTTCTTGTGTGTAGGCGGAGAATGGCCTCCTGTGCCCATGGCGCGGTTGGCCCAAATATGAGTCGCCTTAGGAGTGACGCATGATTGGTGGTGGTTGATTGCACAGTCGTCTCGGGTCATGCGTCTACCTTTGCTAGGGTAAAAGACTCTTGAAATACCCTAATGTGTTGTCATATGACGTCTCTTCGA

Click for details-----ITS1

TCGAATCCTGCATAGCAGAACAACCCGTGAACACGTAACAACAAAAAATGGTTTCGTGAGGATTGATGCTTTTTTGTTTCAGTCCTTGTGAAGCCCACGTCGACGTATGTCTATGGTTTCCTTGTTTGGGCACCTATGGACATCATGTTGTCGCAACAACCACCCCCGGCACAACATGTGCCAAGGAATACTAAACTTAGGAGTTCCCATGCTGTGATCCCCCGTATGCGGTGTGTTCAATGTATGTGGCTTCTTTCAAACACAAAA

Click for details-----ITS2

GTCACGTTGCCTGCATCGAACCTCTGTTATCGTGGTTTCTTGTGTGTAGGCGGAGAATGGCCTCCTGTGCCCATGGCGCGGTTGGCCCAAATATGAGTCGCCTTAGGAGTGACGCATGATTGGTGGTGGTTGATTGCACAGTCGTCTCGGGTCATGCGTCTACCTTTGCTAGGGTAAAAGACTCTTGAAATACCCTAATGTGTTGTCATATGACGTCTCTTCGA

Taxonomic Information

Plant ID: NPO24626
Plant Latin Name: Stevia Origanoides
Taxonomy Genus: Stevia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 558494
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

10 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

7 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC51700

Ingredient ID: NPC307063

Ingredient ID: NPC27184

Ingredient ID: NPC26960

Ingredient ID: NPC264317

Ingredient ID: NPC263414

Ingredient ID: NPC192638

Ingredient ID: NPC178383

Ingredient ID: NPC142415

Ingredient ID: NPC121162

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Protein Phosphatase	CDC25B	Dual specificity phosphatase Cdc25B	P30305	CHEMBL4804
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	5

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00701987	Safety, Tolerability, and Preliminary Efficacy Study of ALS-357 in Patients With Cutaneous Metastatic Melanoma	melanoma	Betulinic Acid (NPC264317)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT00346502	Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia)	dysplastic nevus	Betulinic Acid (NPC264317)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	AKR1B10,RECQL,CES1,PTPN1,PTPRC,CDC25B
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	AKR1B10,RECQL,PTPRC,CDC25B
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	F3,RELA,RORC
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RELA,RORC AKR1B10
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	AKR1B10,RORC,PTPRC
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	PTPN1,AKR1B10,CDC25B
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPN1,F3,RECQL
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	AKR1B10,AKR1B10,CDC25B
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	RELA,PTPRC
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	PTPN1 NCT02337933
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RORC,RELA
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	CDC25B,RORC
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	PTPN1,RELA
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	AKR1B10,RORC
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	AKR1B10,PTPRC
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3,RORC
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	AKR1B10,PTPRC
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	AKR1B10,PTPRC
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	PTPRC,CDC25B
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	PTPN1
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	RORC
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	PTPRC
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	PTPN1
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	PTPRC
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	PTPRC
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	RELA
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	PTPRC
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	CDC25B
Ophthalmic devices/implants/grafts injury Disease Category: 23.External causes of morbidity or mortality Disease ICD-11 Code: PK97	PTPN1
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	PTPRC
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	F3
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	CES1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	RELA
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	PTPN1
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	PTPRC
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTPN1
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Dysplastic naevus Disease Category: X.Extension Codes Disease ICD-11 Code: XH9035	NCT00346502
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NCT04403568
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NCT00701987
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	RORC
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	F3
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	AKR1B10
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	CDC25B
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1B10
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	CDC25B
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	PTPRC
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1B10
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	CDC25B
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	F3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	AKR1B10
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	AKR1B10
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	F3
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1B10

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Stevia Origanoides

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

10 All known Ingredients in Total

9 Ingredients with Acceptable Bioavailablity

7 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Mesothelioma of pleura

Solid tumour/cancer

Psoriasis

Serous cystadenoma,borderline malignancy of ovary

Leishmaniasis

Diffuse large B-cell lymphomas

Hepatocellular carcinoma of liver

Acute myeloid leukaemia

Metabolic disorder

Multiple sclerosis

Lung cancer

Type 2 diabetes mellitus

Carcinosarcoma of uterus

Other specified malignant neoplasms of kidney, except renal pelvis

Tetralogy of Fallot

Malignant neoplasms of thymus

Glioblastoma of brain

Germ cell tumour of testis

Atopic eczema

Acute diabete complication

Crohn disease

BCR-ABL1-negative chronic myeloid leukaemia

Breast cancer

Acute respiratory distress syndrome

Diffuse large B-cell lymphoma

Transplant rejection

Diabetes mellitus, type unspecified

Transplanted organ/tissue

Nasopharyngeal cancer

Ophthalmic devices/implants/grafts injury

Mature T-cell lymphoma

Irritable bowel syndrome

Acute/subacute hepatic failure

Muscular dystrophy

Bleeding disorder

Choreiform disorder

Pancreatic cancer

Fungal infection

Chronic arterial occlusive disease

Rheumatoid arthritis

Obesity

Skin and skin-structure infection

Hyper-lipoproteinaemia

Autoimmune disease

Lupus erythematosus

Malignant haematopoietic neoplasm

Synthesis disorder

Peroxisomal disease

Indeterminate colitis

Postoperative inflammation

Primary sclerosing cholangitis

Dysplastic naevus

Prostate cancer

Melanoma

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Adenocarcinoma of stomach

Squamous cell carcinoma of bronchus or lung

Other specified malignant neoplasms ofcolon

Melanoma of skin

Other specified malignant neoplasms of bronchus or lung

Malignant neoplasms of oesophagus