CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Sophora Moorcroftiana

Example Image

PLANiTS DNA barcode

Click for details-----ITS

ATCCTCACAAAGCAGTGCGACCCGTGAATTTGTTTGACTACTTGGGCGCGGCTCGAGGTGCATGGTGCCTCGATCCCGCCTAGTGTCGGGAGGTGCCCGCCTCGAGCGGCCCCCTCCTGGCCTATTAACAAAACCCCGGCGCCGAATGCGCCAAGGAAATAGAGATTGTCTAGCACGCCCTCGACGGCCCGGAGACGGTGCCTGTGTGGTGGCGTTGCGACACCGTATCCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACATCGTTGCCCCAATGCCTTGGCCCTCTTGCAAGGCATAGTACAAGGGGGCGGATGTTGGCTTCCCGCGAGCGATGCCTCACGGTTGGCTGAAAATTGAGCCCGTGGTGGAGTGTGCCGCGATGGATGGTGGTTGAGTAAAAGCTCGAGCCCGATCGTGTGTGTCACCCCTACCGGATATGGGACTCTTTGACCCATGCGCGGCCGTTGGCTGCCCACGACGGGACCTCAG

Click for details-----ITS1

Click for details-----ITS2

ATCGTTGCCCCAATGCCTCGGCCCTGTTGCAAGGCATAGCGAAGGGGCGAATGTTGGCTTCCCGCGAGCGATGCCCTCACGGTTGGCTGAAAATTGAGTCCGTGGTGGAGTGTGCCGCGATGGATGGTGGTTGAGTAAAAGCTCGAGACCGATCGTGTGTGTCACCCCTACCGGATTTGGGACTCCATGACCCATGAGCGGCCGTTGGCTGCCCACGAC

Taxonomic Information

Plant ID: NPO24618
Plant Latin Name: Sophora Moorcroftiana
Taxonomy Genus: Sophora
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 1323965
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

China

Traditional Medicine System:

TCM

Medicinal Functions:

Diuretic; Stomachic

Geographical Distribution

China

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

25 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

11 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC80710

Ingredient ID: NPC76394

Ingredient ID: NPC51579

Ingredient ID: NPC313456

Ingredient ID: NPC308650

Ingredient ID: NPC281131

Ingredient ID: NPC261277

Ingredient ID: NPC243715

Ingredient ID: NPC227744

Ingredient ID: NPC225696

Ingredient ID: NPC223812

Ingredient ID: NPC219818

Ingredient ID: NPC219069

Ingredient ID: NPC218165

Ingredient ID: NPC216630

Ingredient ID: NPC20791

Ingredient ID: NPC203391

Ingredient ID: NPC20309

Ingredient ID: NPC203050

Ingredient ID: NPC143530

Ingredient ID: NPC125062

Ingredient ID: NPC120913

Ingredient ID: NPC116775

Ingredient ID: NPC113733

Ingredient ID: NPC107572

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Therapeutic Target	Enzyme	ALOX12	Arachidonate 12-lipoxygenase	P18054	CHEMBL3687
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Fatty acid binding protein family	FABP4	Fatty acid binding protein adipocyte	P15090	CHEMBL2083
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Lyase	CA2	Carbonic anhydrase II	P00918	CHEMBL205
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR1	Estrogen receptor alpha	P03372	CHEMBL206
Therapeutic Target	Nuclear hormone receptor subfamily 3	ESR2	Estrogen receptor beta	Q92731	CHEMBL242
Therapeutic Target	Oxidoreductase	HSD17B2	Estradiol 17-beta-dehydrogenase 2	P37059	CHEMBL2789
Therapeutic Target	Oxidoreductase	HSD17B10	Endoplasmic reticulum-associated amyloid beta-peptide-binding protein	Q99714	CHEMBL4159
Therapeutic Target	Peptide receptor (family A GPCR)	NPSR1	Neuropeptide S receptor	Q6W5P4	CHEMBL5162
Therapeutic Target	Protein Kinase	CDK1	Cyclin-dependent kinase 1	P06493	CHEMBL308
Therapeutic Target	Protein Kinase	AXL	Tyrosine-protein kinase receptor UFO	P30530	CHEMBL4895
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	YES1	Tyrosine-protein kinase YES	P07947	CHEMBL2073
Therapeutic Target	Protein Kinase	AURKB	Serine/threonine-protein kinase Aurora-B	Q96GD4	CHEMBL2185
Therapeutic Target	Protein Kinase	FLT3	Tyrosine-protein kinase receptor FLT3	P36888	CHEMBL1974
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	PIM1	Serine/threonine-protein kinase PIM1	P11309	CHEMBL2147
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Therapeutic Target	Transcription factor	AHR	Aryl hydrocarbon receptor	P35869	CHEMBL3201

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	21

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT05456022	Therapeutic Efficacy of Quercetin Versus Its Encapsulated Nanoparticle on Tongue Squamous Cell Carcinoma Cell Line	mouth neoplasm	Quercetin (NPC20791)	NP level
NCT02226484	Can Quercetin Increase Claudin-4 and Improve Esophageal Barrier Function in GERD?	gastroesophageal reflux disease	Quercetin (NPC20791)	NP level
NCT01839344	Effects of Quercetin on Blood Sugar and Blood Vessel Function in Type 2 Diabetes.	type 2 diabetes mellitus	Quercetin (NPC20791)	NP level
NCT04907253	Quercetin in Coronary Artery By-pass Surgery	coronary artery disease	Quercetin (NPC20791)	NP level
NCT03943459	Sirtuin-1 and Advanced Glycation End-products in Postmenopausal Women With Coronary Disease	coronary artery disease	Quercetin (NPC20791)	NP level
NCT05276895	Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis	osteoarthritis	Quercetin (NPC20791)	NP level
NCT01720147	Quercetin in Children With Fanconi Anemia; a Pilot Study	Fanconi anemia	Quercetin (NPC20791)	NP level
NCT03989271	Biological Effects of Quercetin in COPD	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Quercetin (NPC20791)	NP level
NCT01348204	Nasal Potential Studies Utilizing Cystic Fibrosis Transmembrane Regulator (CFTR) Modulators	cystic fibrosis	Quercetin (NPC20791)	NP level
NCT04733534	An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer	childhood cancer	Quercetin (NPC20791)	NP level
NCT01912820	Effect of Quercetin on Green Tea Polyphenol Uptake in Prostate Tissue From Patients With Prostate Cancer Undergoing Surgery	prostate adenocarcinoma	Quercetin (NPC20791)	NP level
NCT05422885	Safety and Feasibility of Dasatinib and Quercetin in Adults at Risk for Alzheimer's Disease	aging	Quercetin (NPC20791)	NP level
NCT01438320	Q-Trial in Patients With Hepatitis C	chronic hepatitis C virus infection	Quercetin (NPC20791)	NP level
NCT05062486	A Study to Evaluate the Safety and Efficacy of RQC for AMD	age-related macular degeneration	Quercetin (NPC20791)	NP level
NCT01708278	Beneficial Effects of Quercetin in Chronic Obstructive Pulmonary Disease (COPD)	chronic obstructive pulmonary disease	Quercetin (NPC20791)	NP level
NCT04853199	Quercetin In The Treatment Of SARS-COV 2	COVID-19	Quercetin (NPC20791)	NP level
NCT01375101	Therapeutic Effect of Quercetin and the Current Treatment of Erosive and Atrophic Oral Lichen Planus	oral lichen planus	Quercetin (NPC20791)	NP level
NCT04946383	Safety and Effectivness of Quercetin & Dasatinib on Epigenetic Aging	aging	Quercetin (NPC20791)	NP level
NCT04851821	The Effectiveness of Phytotherapy in SARS-COV2(COVID-19)	COVID-19	Quercetin (NPC20791)	NP level
NCT02848131	Senescence in Chronic Kidney Disease	chronic kidney disease	Quercetin (NPC20791)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	CA7,CDK1,CA12,XDH,AURKB,ALOX12,OR51E2,CYP2C9,NPSR1
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	ALOX15,CA2,CYP1A1,XDH,AURKB,HSD17B2,CYP2C9,CDK1,NPSR1
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	CSNK2A3,CYP19A1,KDR,DPP4,FABP5,CA2,CA12,CYP1B1,MET
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	IGF1R,AXL,FLT3,MET,ALOX5,EGFR,KDR,CDK1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	NOX4,ALOX5,CA7,DPP4,CA12,XDH,CYP1B1,MET
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	ESR1,KDR,CACNA1H,MET,EGFR,SRC,TP53
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	NOX4,FABP5,CA2,XDH,CA4,OR51E2,MET
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	NOX4,ALOX15,CYP19A1,AURKB,CDK1,MET,NPSR1
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA7,CA12,XDH,AURKB,CYP2C9,CDK1,NPSR1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	AURKB,TP53,AXL,SRC,FLT3,PIM1
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	IGF1R,KDR,FLT3,EGFR,TP53,MET
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	SRC,DPP4,AURKB,FLT3,TP53,CDK1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	SRC,FLT3,KDR,AHR,IGF1R,AXL
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	SRC,KDR,FLT3,MET,TP53,CACNA1H
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	CA2,CYP1A1,CA12,CYP1A2,AURKB,MET
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	AXL,EGFR,TP53,KDR,AHR
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	EGFR,IGF1R,SRC,CACNA1G,TP53
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	KDR,EGFR,CSNK2A1,IGF1R,MET
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DPP4,AHR,ALOX5,FLT3 FABP5
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,ALOX15,FABP5,OR51E2 NCT01912820
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	NOX4,CYP1A1,TYR,MET,NPSR1
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	NOX4,ALOX15,AURKB,CDK1,NPSR1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	CA2,CYP1A2,AURKB,CYP2C9,CDK1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ALOX15,CA2,CYP1A1,CYP2C9,ESR2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	AXL,CYP19A1,XDH,CACNA1G,EGFR
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	ESR1,CA12,CACNA1H,AURKB,CDK1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	NOX4,ESR1,DPP4,CYP1B1,OR51E2
Bacterial infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-1C4Z	CA2,CA4,CA12,CYP2C9
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	SRC,TP53,AXL,EGFR
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	MET,KDR,TP53,EGFR
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	KDR,ESR2,FLT3,MET
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	EGFR,TP53,MET,KDR
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	EGFR,TYR,MET,KDR
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	KDR,TP53,SRC,FLT3
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	FABP4,NOX4,AURKB,NPSR1
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	CYP19A1,AXL,DPP4,MET
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	CA12,XDH,AURKB,CDK1
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	SRC,DPP4,CA4,CA2
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET,CACNA1G,HSD17B2,AXL
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	CA2,ALOX5,ABCG2
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	EGFR,KDR,MET
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	IGF1R,CACNA1H,ALOX5
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AURKB,KDR,DPP4
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	TP53,MET,DPP4
Seborrhoeic dermatitis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA81	CA2,CA4,CA12
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AURKB,ESR2,ESR1
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	KDR,MET,EGFR
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	XDH,IGF1R NCT02848131
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	EGFR,FLT3,KDR
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR,ALOX5,CDK1
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CA4,MET,CA2
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	ALOX5,ESR1,IGF1R
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	SRC,MET,KDR
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	AHR,ALOX5,KDR
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	EGFR,KDR,MET
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	SRC,KDR,MET
Osteoarthritis, unspecified Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA0Z	CDK1,HSD17B2,CA12
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	ABCG2,CACNA1H,AURKB
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	NOX4,DPP4,FLT3
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	NOX4,IGF1R,ABCG2
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	MET,FLT3,AXL
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	POLB,XDH,MET,CA12,TP53,AHR,SRC,AURKB,CA2,ESR1,AXL,ALOX5,CA4,EGFR,CDK1,KDR,YES1,IGF1R,FLT3,CSNK2A1,PIM1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CA7,ALOX15,DPP4,CA2,RECQL,AURKB,OR51E2,CYP2C9,CACNA1G,AXL,ALOX5,NPSR1,ABCG2,PIM1,POLB,CYP1B1,MET,HSD17B2,CACNA1H,XDH,CISD1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CA7,ALOX15,DPP4,RECQL,AURKB,OR51E2,AXL,ALOX5,SRC,EGFR,AHR,PIM1,FLT3,MET,CDK1,HSD17B2,CSNK2A2,KDR,CA12,XDH,TYR
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FABP4,HSD17B10,RECQL,AURKB,OR51E2,CACNA1G,TP53,AXL,SRC,FABP5,EGFR,AHR,MET,CDK1,CSNK2A2,NOX4,KDR,CA12,CISD1,ESR2
Influenza Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E30-1E32	ALOX5,XDH
Low bone mass disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB83	ESR1,CA2
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	ESR1,DPP4
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	TP53,SRC
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR,ESR2
Unspecified viral infection of unspecified site Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D9Z	FLT3,ESR1
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC,TP53
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	ESR2,CYP19A1
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	SRC,FLT3
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC,TP53
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	CDK1,FLT3
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	ESR1,CYP19A1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	SRC,ESR1
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	FLT3,SRC
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R,CACNA1G
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	AHR,ALOX5
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	ESR1,ESR2
Menopausal disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA30	ESR1,ESR2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	CA2,XDH
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	CA2,CACNA1G
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	ALOX5,FLT3
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	SRC,KDR
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CA4,ALOX5
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	IGF1R,SRC
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	SRC,KDR
NA Disease Category: NA Disease ICD-11 Code: NA	MET,NOX4
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	MET,KDR
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	EGFR,MET
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DPP4 NCT01839344
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	SRC,EGFR
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC,ALOX5
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NCT03989271,NCT01708278
COVID-19 Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D6Y	NCT04853199,NCT04851821
coronary artery disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA8Y-BA8Z	NCT03943459,NCT04907253
Ageing associated decline in intrinsic capacity Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG2A	NCT05422885,NCT04946383
Coeliac disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA95	CDK1,CYP1A1
Myelodysplastic syndromes, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A3Z	CYP2C9,PIM1
Keratoconus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A78.50	CACNA1H,CA4
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	ABCG2,CA4
Systemic sclerosis Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A42	FABP4,NOX4
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	YES1,CYP1A1
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	ABCG2,CYP1B1
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AHR,NOX4
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	HSD17B10,CA7,ALOX15,DPP4,CA2,AURKB,CACNA1G,YES1,TP53,CYP19A1,FABP5,NPSR1,POLB,MET,HSD17B2,XDH,CISD1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CSNK2A3,ALOX15,ESR1,CA2,YES1,TP53,ALOX5,FABP5,AHR,MET,HSD17B2,NOX4,CA12,CYP1A2,XDH,CISD1,ALOX12
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DPP4,CYP2C9,CACNA1G,ALOX5,FABP5,CA4,NPSR1,AHR,ABCG2,MET,CDK1,HSD17B2,NOX4,KDR,CA12,XDH,ALOX12
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	FABP4,NOX4,CYP19A1,CDK1,FABP5,CA12,AURKB,CA4,OR51E2,CACNA1G,CYP19A1,SRC,CA12,AURKB,CDK1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	ESR2,CA12,MET,EGFR,CA4,AXL,ESR1,IGF1R,CDK1,CYP19A1,SRC,CA2,KDR
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	IGF1R,CSNK2A3,AURKB,OR51E2,TP53,ALOX5,SRC,FABP5,CA4,CDK1,NOX4,ALOX12,ESR2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	NOX4,CA7,CYP19A1,DPP4,FABP5,CA12,AURKB,CA4,HSD17B2,OR51E2,CDK1,CACNA1G,MET
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	CYP19A1,ALOX5,FABP5,XDH,AURKB,TYR,CYP2C9,MET,ALOX5,FABP5,AURKB,OR51E2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	FABP4,NOX4,IGF1R,CYP19A1,SRC,FABP5,CA12,AURKB,CA4,OR51E2,CDK1
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	HSD17B10,ALOX15,DPP4,FABP5,CISD1,FLT3,CYP1B1,HSD17B2,CYP2C9,CACNA1G
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	EGFR
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	CACNA1G
Metastatic tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E2Z	ESR1
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	ESR1
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ESR2
Male infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB04	ESR1
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Chronic myelomonocytic leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A40	FLT3
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	ALOX5
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	ALOX5
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Duodenal ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA63	CA2
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	ESR1
Filariasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F66	ALOX5
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Epilepsy/seizure Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A61-8A6Z	CACNA1G
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Gout Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA25	XDH
Adrenal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	ESR1
Esophageal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	TP53
Transplant rejection Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE84	TP53
Encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E47	XDH
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	DPP4
Bladder cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	TP53
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	ESR2
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Skeletal anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD24	ESR1
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	IGF1R
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	ABCG2
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Lip/oral cavity/pharynx neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6E	TP53
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	CYP19A1
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	FLT3
Liposarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B59	TP53
Sepsis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G40-1G41	ESR2
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	ESR2
Female infertility Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA31	ESR1
Breast in situ carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E65	ESR1
Transplanted organ/tissue Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QB63	FLT3
Diffuse large B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	FLT3
Vaginitis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA02	ESR1
Metastatic liver/bile duct neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D80	TP53
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	CACNA1H
Human immunodeficiency virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C60-1C62	FLT3
Inborn purine/pyrimidine/nucleotide metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C55	XDH
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	FLT3
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Female genital tract noninflammatory disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA1Y	ESR1
Mineral deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B5K	XDH
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Kidney failure Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB60-GB6Z	TP53
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	DPP4
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SRC
Menstrual cycle bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20	ESR1
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	FLT3
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	EGFR
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Dyspareunia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA12	ESR1
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	EGFR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CYP19A1
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	CA2
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	FLT3
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	AXL
Autism spectrum disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A02	DPP4
Acidosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C73	CACNA1H
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Ovarian dysfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80	TP53
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CACNA1G
Ureteral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C92	AHR
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Cystic fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA25	NCT01348204
Malignant neoplasms of other or unspecified parts of mouth Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B66	NCT05456022
Chronic hepatitis C Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E51.1	NCT01438320
Macular degeneration Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B75	NCT05062486
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	NCT05276895
Congenital aplastic anaemia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A70.0	NCT01720147
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Gastro-oesophageal reflux disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA22	NCT02226484
Unspecified malignant neoplasms of unspecified sites Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D4Z	NCT04733534
Lichen planus Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA91	NCT01375101
Inflammatory bowel diseases, unspecified Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD7Z	NOX4
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	AXL
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	CACNA1G
Atrial fibrillation Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC81.3	CA7
Non-alcoholic fatty liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92	FABP4
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	CYP1A1
Malignant neoplasms of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	FABP4
Pre-eclampsia Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA24	CA4
Pneumonia due to Pseudomonasaeruginosa Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA40.05	DPP4
Chronic rhinosinusitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA0A	CYP1A1
Malignant neoplasms of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	FABP4
Dilated cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.0	ABCG2
Malignant neoplasm of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	FABP4
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Sophora Moorcroftiana

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

Medicinal Functions:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

25 All known Ingredients in Total

11 Ingredients with Acceptable Bioavailablity

12 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Squamous cell carcinoma of bronchus or lung

Malignant neoplasms of corpus uteri, unspecified

Glioblastoma of brain

Lung cancer

Malignant neoplasms of thyroid gland, unspecified

Brain cancer

Pheochromocytoma

Adenocarcinoma of stomach

Adenocarcinoma of bronchus or lung

Acute myeloid leukaemia

Colorectal cancer

Malignant haematopoietic neoplasm

Multiple myeloma

Ovarian cancer

Renal cell carcinoma, chromophobe type

Myelodysplastic syndrome

Pancreatic cancer

Liver cancer

Psoriasis

Adenocarcinoma of prostate

Other specified malignant neoplasms ofcolon

Malignant neoplasms of oesophagus

Urothelial carcinoma of bladder

Cytomegaloviral disease

Chikungunya virus disease

Invasive carcinoma of breast

Carpal tunnel syndrome

Bacterial infection

Mature B-cell leukaemia

Stomach cancer

Alzheimer disease

Head and neck cancer

Melanoma

Peritoneal cancer

Malignant neoplasm metastasis in lymph nodes of head, face or neck

West Nile virus infection

Other specified malignant neoplasms of bronchus or lung

Superficial ovarian endometriosis

Ebola virus disease

Rheumatoid arthritis

Non-small cell lung cancer

Pain, unspecified

Acute diabete complication

Chronic arterial occlusive disease

Seborrhoeic dermatitis

Prostate cancer

Metastatic lymph node neoplasm

Chronic kidney disease

Chronic pain

Nasopharyngeal cancer

Glaucoma

Pituitary gland disorder

Cardiovascular disease

Thrombocytopenia

Renal cell carcinoma

Pleomorphic sarcoma

Osteoarthritis, unspecified

Dengue fever, unspecified

Leishmaniasis

Melanoma of skin

Human immunodeficiency virus disease without mention of tuberculosis or malaria