CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Schkuhria Pinnata

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCAAAACCTGCATAGCAGAACGACCAGCGAACTTGTACCAACATAATGGTTTGGCGGCGACCGGTACGTTTTGTTTCGGGCGTCGTTAAGCCTAGTCGGCGTGTGTCCATTGTCTTCAATTGAGGAGTCGTGGACATCACGTTGGCGCAACAACAACCCCCCGGCACGGAATGTGCCAAGGAAAACAAAACTTTAGAGGGCTCGTGCCATGACACTCCGTTTTTCGGAGCGCTCATGGTATGCTGCTTCTTTTAAACATAAAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGTTGAGGGCACGTCTGCCTGGGCGTCACGCATCACATCGCCCCCACCAAWCATCCCTTCTCGGGTTGCTTATGATTGGGGCGGATATTGGTCTCCCGTGCTAATGACGCGGTTGGCCTAAATACGAGTCTCCTTAGGAGGGACGCACGGCTAGTGGTGGTTGATTACACGGTCGTCTCGTGTCGTGCGTTTTAAATCTCTTTGGGAAAGCTCTTAAAAAACCCGATGTTTTGTCTTTTGATGATTCCTCGA

Click for details-----ITS1

TCGAAACCTGCATAGCAGAACGACCAGCGAACTTGTACCAACATAATGGTTTGGCGGCGACCGGTACGTTTTGTTTCGGGCGTCGTTAAGCCTAGTCGGCGTGTGTCCATTGTCTTCAATTGAGGAGTCGTGGACATCACGTTGGCGCAACAACAACCCCCCGGCACGGAATGTGCCAAGGAAAACAAAACTTTAGAGGGCTCGTGCCATGACACTCCGTTTTTCGGAGCGCTCATGGTATGCTGCTTCTTTTAAACATAAAAA

Click for details-----ITS2

ATCACATCGCCCCCACCAAWCATCCCTTCTCGGGTTGCTTATGATTGGGGCGGATATTGGTCTCCCGTGCTAATGACGCGGTTGGCCTAAATACGAGTCTCCTTAGGAGGGACGCACGGCTAGTGGTGGTTGATTACACGGTCGTCTCGTGTCGTGCGTTTTAAATCTCTTTGGGAAAGCTCTTAAAAAACCCGATGTTTTGTCTTTTGATGATTCCTCGA

Taxonomic Information

Plant ID: NPO2440
Plant Latin Name: Schkuhria Pinnata
Taxonomy Genus: Schkuhria
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 176579
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

30 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

24 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

26 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC96018

Ingredient ID: NPC59330

Ingredient ID: NPC513

Ingredient ID: NPC50362

Ingredient ID: NPC48657

Ingredient ID: NPC486042

Ingredient ID: NPC486041

Ingredient ID: NPC486040

Ingredient ID: NPC486039

Ingredient ID: NPC486038

Ingredient ID: NPC486037

Ingredient ID: NPC486036

Ingredient ID: NPC486035

Ingredient ID: NPC486034

Ingredient ID: NPC486033

Ingredient ID: NPC486032

Ingredient ID: NPC486031

Ingredient ID: NPC486029

Ingredient ID: NPC478929

Ingredient ID: NPC298801

Ingredient ID: NPC281005

Ingredient ID: NPC276771

Ingredient ID: NPC269509

Ingredient ID: NPC261199

Ingredient ID: NPC257040

Ingredient ID: NPC237946

Ingredient ID: NPC156222

Ingredient ID: NPC137138

Ingredient ID: NPC134725

Ingredient ID: NPC103490

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 3	CYP3A4	Cytochrome P450 3A4	P08684	CHEMBL340
Therapeutic Target	Hydrolase	RAB9A	Ras-related protein Rab-9A	P51151	CHEMBL1293294
Therapeutic Target	Methyl-lysine/arginine binding protein	SMN1	Survival motor neuron protein	Q16637	CHEMBL1293232
Therapeutic Target	Nuclear hormone receptor subfamily 3	NR3C1	Glucocorticoid receptor	P04150	CHEMBL2034
Therapeutic Target	Oxidoreductase	PTGS2	Cyclooxygenase-2	P35354	CHEMBL230
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	HIF1A	Hypoxia-inducible factor 1 alpha	Q16665	CHEMBL4261
Therapeutic Target	Transcription factor	PAX8	Paired box protein Pax-8	Q06710	CHEMBL2362980
Therapeutic Target	Transporter	NPC1	Niemann-Pick C1 protein	O15118	CHEMBL1293277

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT03532776	Comparison Between Podofilox Topical Gel 0.5% and Allergan's Condylox® Gel 0.5% for External Anogenital Warts	anogenital venereal wart	Podofilox (NPC237946)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	TUBB6,KIT,PTGS2,HIF1A,NPC1,LMNA,PAX8
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	HIF1A,PTGS2,KIT,NR3C1,CYP3A4
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NR3C1,PTGS2,NR3C1,CYP3A4
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	TUBB6,HIF1A,LMNA,PAX8
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TUBB6,SMN1,LMNA,PAX8
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	SMN1,LMNA,NPC1,PAX8
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	TUBB6,LMNA,PTGS2,RAB9A
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	TUBB6,LMNA,PTGS2,RAB9A
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	RAB9A,KIT,HIF1A,SMN1
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	PTGS2,KIT,NR3C1
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	KIT,NPC1,CYP3A4
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	NR3C1,KIT,CYP3A4
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NR3C1,PTGS2
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	HIF1A,KIT
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NR3C1,PTGS2
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	PTGS2,KIT
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NR3C1,PTGS2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	NR3C1,PTGS2
Muscular atrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B61	SMN2,SMN1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	PTGS2,PAX8
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	KIT,NR3C1
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	PAX8,CYP3A4
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,HIF1A
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	KIT
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	NR3C1
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NR3C1
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	PTGS2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	PTGS2
Inflammatory spondyloarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA92	PTGS2
Otitis media Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA80-AB0Z	PTGS2
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NR3C1
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	KIT
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	NR3C1
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	KIT
Mastocytosis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A21	KIT
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	NR3C1
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	NR3C1
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RAB9A
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	HIF1A
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	PTGS2
HIV-infected patients with tuberculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1B10-1B14	PTGS2
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	KIT
Endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10	PTGS2
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	NR3C1
Vasomotor/allergic rhinitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA08	NR3C1
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	KIT
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KIT
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	KIT
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	KIT
Urinary system disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC2Z	PTGS2
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	NR3C1
Cushing syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A70	NR3C1
Malignant intestine neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C0Z	KIT
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	PTGS2
Adaptive immunity immunodeficiency Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A01	NR3C1
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	PTGS2
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Inherited coagulation factor deficiency Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B14	PTGS2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KIT
Oesophagitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA24	NR3C1
Adrenogenital disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A71	NR3C1
Joint pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME82	PTGS2
Inflammatory arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA2Z	KIT
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	PTGS2
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	NR3C1
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	NR3C1
Osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA00-FA05	PTGS2
Spine/trunk injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND51	NR3C1
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	PTGS2
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	KIT
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	NR3C1
Vitamin deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B55-5B5F	NR3C1
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	PTGS2
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	PTGS2
Spinal pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME84	PTGS2
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	NR3C1
Phakomatoses/hamartoneoplastic syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2D	KIT
Bone/articular cartilage neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F7B	KIT
Reactive arthropathy Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA11	PTGS2
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	HIF1A
Otitis externa Disease Category: 10.Diseases of the ear or mastoid process Disease ICD-11 Code: AA00-AA13	NR3C1
Knee osteoarthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA01	PTGS2
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	CYP3A4
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	KIT
Anogenital warts Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A95	NCT03532776
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	PTGS2
Non-alcoholic steatohepatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB92.1	PTGS2
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	KIT
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	PTGS2
Malignant neoplasms of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94	PTGS2
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	PTGS2
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KIT
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	PAX8
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	PAX8
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	KIT
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	CYP3A4
Heart failure, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD1Z	PTGS2
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	PTGS2
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	TUBB6

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Schkuhria Pinnata

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

30 All known Ingredients in Total

24 Ingredients with Acceptable Bioavailablity

26 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Adenocarcinoma of pancreas

Solid tumour/cancer

Atopic eczema

Malignant neoplasms of biliary tract, distal bile duct

Diffuse large B-cell lymphomas

Mesothelioma of pleura

Superficial ovarian endometriosis

Glioblastoma of brain

Germ cell tumour of testis

Postoperative inflammation

Renal cell carcinoma, chromophobe type

Malignant neoplasms of adrenal gland

Rheumatoid arthritis

Brain cancer

Indeterminate colitis

Alzheimer disease

Type 2 diabetes mellitus

Asthma

Muscular atrophy

Carcinosarcoma of uterus

Pheochromocytoma

Urothelial carcinoma of bladder

Chikungunya virus disease

Acute myeloid leukaemia

Retinopathy

Multiple sclerosis

Cerebral ischaemia

Cardiovascular disease

Inflammatory spondyloarthritis

Otitis media

Muscular dystrophy

Multiple myeloma

Prostate cancer

Renal cell carcinoma

Mastocytosis

Herpes simplex infection

Breast cancer

Fungal infection

Mature T-cell lymphoma

Female pelvic pain

HIV-infected patients with tuberculosis

Colorectal cancer

Endometriosis

Mood disorder

Vasomotor/allergic rhinitis

Thrombocytopenia

Myelodysplastic syndrome

Myeloproliferative neoplasm

Gastrointestinal stromal tumour

Urinary system disease

Substance abuse

Cushing syndrome

Malignant intestine neoplasm

Parkinsonism

Adaptive immunity immunodeficiency

Hyper-lipoproteinaemia

Adrenomedullary hyperfunction

Inherited coagulation factor deficiency

Lung cancer

Oesophagitis

Adrenogenital disorder

Joint pain

Inflammatory arthropathy

Pain, unspecified