• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Lupinus Albus


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAGCCTCACAAGCAGTGCGACCCCGTGAATTTGTTTTACTACTCAGGGGTGGCTAGAGGTGTTTGGCACCTCGGCCCCCCTCGTGTCAGGAGGCGCCACACCCTGTGCGGTCTCCTCCTGGCCTAATAACAAAACCCCGGCGCCGAACGCGCCAAGGAAATTGAAATCGTTTAGTTCGCCCCCGTCGGCCCGGAGACGGTGCTCGTGCGGGCGGCGTTGCGACACGCTTATCCTAAAGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGCCTGCCTGGGTGTTGCACATCGTTGCCCCCGTGCCTTGGCCACGTGCTAGGCACCAAGCGGGGCGAATGTTGGCTTCCCGTGAGCAATGTCTCACGGTTGGTTGAAAACTGAGTCCGCGGTGGAGGGCGCCGTGATGGATGGTGGCTGAGTTAATGCTCGAGACCGATCGTGCGTGTTACCCCCACCAGCTTTGCGACTCTTTGACCCATGGGGGTCTGTTGGCCTCCTAATACGGGAACCTCAGG

Click for details-----ITS1

NA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO24342
Plant Latin Name: Lupinus Albus
Taxonomy Genus: Lupinus
Taxonomy Family: Fabaceae

Plant External Links:

NCBI TaxonomyDB: 3870
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

90 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


82 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

56 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC94167

Ingredient ID: NPC93888

Ingredient ID: NPC92193

Ingredient ID: NPC90973

Ingredient ID: NPC89879

Ingredient ID: NPC86018

Ingredient ID: NPC85813

Ingredient ID: NPC84733

Ingredient ID: NPC80379

Ingredient ID: NPC79213

Ingredient ID: NPC66183

Ingredient ID: NPC62045

Ingredient ID: NPC55412

Ingredient ID: NPC53164

Ingredient ID: NPC53118

Ingredient ID: NPC52101

Ingredient ID: NPC489908

Ingredient ID: NPC489907

Ingredient ID: NPC48624

Ingredient ID: NPC45386

Ingredient ID: NPC39426

Ingredient ID: NPC35761

Ingredient ID: NPC34908

Ingredient ID: NPC328447

Ingredient ID: NPC317120

Ingredient ID: NPC311918

Ingredient ID: NPC311330

Ingredient ID: NPC308906

Ingredient ID: NPC294548

Ingredient ID: NPC290144

Ingredient ID: NPC289536

Ingredient ID: NPC281686

Ingredient ID: NPC280638

Ingredient ID: NPC274811

Ingredient ID: NPC272614

Ingredient ID: NPC271802

Ingredient ID: NPC269919

Ingredient ID: NPC268204

Ingredient ID: NPC267408

Ingredient ID: NPC266441

Ingredient ID: NPC261831

Ingredient ID: NPC261388

Ingredient ID: NPC259166

Ingredient ID: NPC25897

Ingredient ID: NPC2577

Ingredient ID: NPC256669

Ingredient ID: NPC251672

Ingredient ID: NPC248642

Ingredient ID: NPC247251

Ingredient ID: NPC242923

Ingredient ID: NPC237812

Ingredient ID: NPC237227

Ingredient ID: NPC226479

Ingredient ID: NPC226453

Ingredient ID: NPC218636

Ingredient ID: NPC214116

Ingredient ID: NPC212799

Ingredient ID: NPC210434

Ingredient ID: NPC208793

Ingredient ID: NPC208790

Ingredient ID: NPC203468

Ingredient ID: NPC201844

Ingredient ID: NPC201284

Ingredient ID: NPC200743

Ingredient ID: NPC19990

Ingredient ID: NPC18787

Ingredient ID: NPC187770

Ingredient ID: NPC186321

Ingredient ID: NPC185755

Ingredient ID: NPC174628

Ingredient ID: NPC174246

Ingredient ID: NPC167400

Ingredient ID: NPC166722

Ingredient ID: NPC156215

Ingredient ID: NPC152451

Ingredient ID: NPC150950

Ingredient ID: NPC148436

Ingredient ID: NPC147983

Ingredient ID: NPC144680

Ingredient ID: NPC137958

Ingredient ID: NPC136924

Ingredient ID: NPC13397

Ingredient ID: NPC126681

Ingredient ID: NPC126492

Ingredient ID: NPC126284

Ingredient ID: NPC120649

Ingredient ID: NPC119182

Ingredient ID: NPC115059

Ingredient ID: NPC11433

Ingredient ID: NPC112890