• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Pistacia Chinensis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAAACCTGCCAAGCAGAACGACCCGCGAACCTGTCATCACATCGGGGGCCTGCGGGCTTCGTGCCCGTGTGCCTCCACCCGTGCTTCGTCGGGTGTCGGTCGCACGCTTGTGCGTGCGGCCGCCCCGTCGTTGCGCATTAACGAACCCCGGCGCGAATTGCGCCAAGGAAATCTTAACGAGAGAGCTCGCTCCCGTCGCCCCGGACACGGTGCGCGCGCGGGATGCGTGGCCTTCTTTCATTATCAATAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGTGTCACGCATCGTTGCCCCCCGCCCAAATCCTACGATCTTGCGGCGGTGGGCGGAAAATGGCCTCCCGTGTGCTTGCGCCCGCGGTTGGCCCAAATCCGAGTTCTCGGTGACGCTTCCCGCGACAATCGGTGGCGTTTGAAACAGAACCTAGTGATCCTGTCGTGCGGTCGCGTTCTCCTGTCCACGGACTCTTTGACCCTCGAGAGCAAGCGAAAGCGCGCTCGCATTGCGACCCCAGGTCAGGCGGGATTACC

Click for details-----ITS1

GCGGAAGGATCATTGTCGAAACCTGCCAAGCAGAACGACCCGCGAACCTGTCATCACATCGGGGGCCTGCGGGCTTCGTGCCCGTGTGCCTCCACCCGTGCTTCGTCGGGTGTCGGTCGCACGCTTGTGCCTACGGCCGCCCCGTCGTTGCGCATTAACGAACCCCGGCGCGAATTGCGCCAAGGAAATCTTAACGAGAGAGCTCGCTCCCGTCGCCCCGGACACGGTGCGCGCGCGGGATGCGTGGCCTTCTTTCATTATCAATAA

Click for details-----ITS2

ATCGTTGCCCCCCGCCCAAATCCTACGATCTTGCGGCGGTGGGCGGAAAATGGCCTCCCGTGTGCTTGCGCCCGCGGTTGGCCCAAATCCGAGTTCTCGGTGACGCTTCCCGCGACAATCGGTGGCGTTTGAAACAGAACCTAGTGATCCTGTCGTGCGGTCGCGTTCTCCTGTCCACGGACTCTTTGACCCTCGAGAGCAAGCGAAAGCGCGCTCGCATTGCGACCCCAGGTCAGGCGGGATTACC
Taxonomic Information

Plant ID: NPO24278
Plant Latin Name: Pistacia Chinensis
Taxonomy Genus: Pistacia
Taxonomy Family: Anacardiaceae

Plant External Links:

NCBI TaxonomyDB: 289741
Plant-of-the-World-Online: 70242-1

Used in Medicines

Country/Region:
China; India

Traditional Medicine System:
Indian Folk; TCM; Unani; Ayurveda


Medicinal Functions:

Miscellany

Geographical Distribution

United States; India; Georgia; China

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available
Compounds Summary

Overview of Ingredients

112 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


64 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

24 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.





Ingredient Structrual Cards

Ingredient ID: NPC98663

Ingredient ID: NPC94581

Ingredient ID: NPC94337

Ingredient ID: NPC93157

Ingredient ID: NPC92867

Ingredient ID: NPC92793

Ingredient ID: NPC92348

Ingredient ID: NPC86893

Ingredient ID: NPC79303

Ingredient ID: NPC77040

Ingredient ID: NPC7151

Ingredient ID: NPC66770

Ingredient ID: NPC63584

Ingredient ID: NPC62192

Ingredient ID: NPC57114

Ingredient ID: NPC52692

Ingredient ID: NPC51443

Ingredient ID: NPC50905

Ingredient ID: NPC48915

Ingredient ID: NPC42424

Ingredient ID: NPC40848

Ingredient ID: NPC37315

Ingredient ID: NPC36900

Ingredient ID: NPC36835

Ingredient ID: NPC36765

Ingredient ID: NPC35314

Ingredient ID: NPC32817

Ingredient ID: NPC327756

Ingredient ID: NPC319287

Ingredient ID: NPC308311

Ingredient ID: NPC30784

Ingredient ID: NPC306270

Ingredient ID: NPC305244

Ingredient ID: NPC30506

Ingredient ID: NPC297587

Ingredient ID: NPC28705

Ingredient ID: NPC284261

Ingredient ID: NPC282414

Ingredient ID: NPC281388

Ingredient ID: NPC280443

Ingredient ID: NPC273589

Ingredient ID: NPC270452

Ingredient ID: NPC265526

Ingredient ID: NPC264617

Ingredient ID: NPC262410

Ingredient ID: NPC260526

Ingredient ID: NPC260491

Ingredient ID: NPC259588

Ingredient ID: NPC258037

Ingredient ID: NPC254212

Ingredient ID: NPC254121

Ingredient ID: NPC248213

Ingredient ID: NPC244471

Ingredient ID: NPC239770

Ingredient ID: NPC236287

Ingredient ID: NPC234709

Ingredient ID: NPC231284

Ingredient ID: NPC229857

Ingredient ID: NPC225710

Ingredient ID: NPC225524

Ingredient ID: NPC2238

Ingredient ID: NPC223588

Ingredient ID: NPC223140

Ingredient ID: NPC221104

Ingredient ID: NPC220705

Ingredient ID: NPC220440

Ingredient ID: NPC219953

Ingredient ID: NPC217582

Ingredient ID: NPC217091

Ingredient ID: NPC210915

Ingredient ID: NPC209043

Ingredient ID: NPC195810

Ingredient ID: NPC185226

Ingredient ID: NPC184548

Ingredient ID: NPC184170

Ingredient ID: NPC182080

Ingredient ID: NPC178881

Ingredient ID: NPC178507

Ingredient ID: NPC176130

Ingredient ID: NPC174513

Ingredient ID: NPC172259

Ingredient ID: NPC171630

Ingredient ID: NPC171572

Ingredient ID: NPC17031

Ingredient ID: NPC168619

Ingredient ID: NPC165578

Ingredient ID: NPC165550

Ingredient ID: NPC161923

Ingredient ID: NPC159181

Ingredient ID: NPC157168

Ingredient ID: NPC156961

Ingredient ID: NPC156654

Ingredient ID: NPC151143

Ingredient ID: NPC149702

Ingredient ID: NPC149423

Ingredient ID: NPC146122

Ingredient ID: NPC145726

Ingredient ID: NPC143928

Ingredient ID: NPC138362

Ingredient ID: NPC137777

Ingredient ID: NPC135139

Ingredient ID: NPC133014

Ingredient ID: NPC132784

Ingredient ID: NPC130833

Ingredient ID: NPC126446

Ingredient ID: NPC125865

Ingredient ID: NPC124822

Ingredient ID: NPC123017

Ingredient ID: NPC111242

Ingredient ID: NPC109592

Ingredient ID: NPC106361

Ingredient ID: NPC103382

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM
Target Type: Individual Protein of Homo sapiens
*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.
.

Detailed Information of Target Proteins

Target Type Protein Class Gene ID Protein Name Uniprot ID Target ChEMBL ID
Therapeutic Target Enzyme ALOX12 Arachidonate 12-lipoxygenase P18054 CHEMBL3687
Therapeutic Target Enzyme APEX1 DNA-(apurinic or apyrimidinic site) lyase P27695 CHEMBL5619
Therapeutic Target Hydrolase ACHE Acetylcholinesterase P22303 CHEMBL220
Therapeutic Target Lyase CA14 Carbonic anhydrase XIV Q9ULX7 CHEMBL3510
Therapeutic Target Lyase CA2 Carbonic anhydrase II P00918 CHEMBL205
Therapeutic Target Lysine demethylase KDM4E Lysine-specific demethylase 4D-like B2RXH2 CHEMBL1293226
Therapeutic Target Protein Kinase CDK6 Cyclin-dependent kinase 6 Q00534 CHEMBL2508
Therapeutic Target Protein Kinase CSNK2A1 Casein kinase II alpha P68400 CHEMBL3629
Therapeutic Target Structural protein LMNA Prelamin-A/C P02545 CHEMBL1293235
Therapeutic Target Transferase FUT7 Alpha-(1,3)-fucosyltransferase 7 Q11130 CHEMBL3596077
Clinical Trials Summary
Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type Number of clinical trials
NP level9
Clinical trial details
NCT ID Title Condition Form in clinical use Associated by plant or compound
NCT04733534 An Open-Label Intervention Trial to Reduce Senescence and Improve Frailty in Adult Survivors of Childhood Cancer childhood cancer Fisetin (NPC51443) NP level
NCT04770064 Targeting Senescence to Reduce Osteoarthritis Pain and cartilagE Breakdown (ROPE) osteoarthritis, knee Fisetin (NPC51443) NP level
NCT04476953 COVID-FISETIN: Pilot in SARS-CoV-2 of Fisetin to Alleviate Dysfunction and Inflammation COVID-19 Fisetin (NPC51443) NP level
NCT05276895 Effect of Natural Senolytic Agents & NLRP3 Inhibitors on Osteoarthritis osteoarthritis Fisetin (NPC51443) NP level
NCT04815902 Use of Senolytic and Anti-Fibrotic Agents to Improve the Beneficial Effect of Bone Marrow Stem Cells for Osteoarthritis osteoarthritis, knee Fisetin (NPC51443) NP level
NCT04771611 COVFIS-HOME: COVID-19 Pilot Study of Fisetin to Alleviate Dysfunction and Decrease Complications COVID-19 Fisetin (NPC51443) NP level
NCT04537299 COVID-FIS: Pilot in COVID-19 (SARS-CoV-2) of Fisetin in Older Adults in Nursing Homes COVID-19;severe acute respiratory syndrome Fisetin (NPC51443) NP level
NCT04210986 Senolytic Drugs Attenuate Osteoarthritis-Related Articular Cartilage Degeneration: A Clinical Trial osteoarthritis, knee Fisetin (NPC51443) NP level
NCT05416515 A Study of Fisetin to Treat Carpal Tunnel Syndrome carpal tunnel syndrome Fisetin (NPC51443) NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

 How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
 ❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant
Association Type & Detailed Evidence
Carcinosarcoma of uterus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.43
 CA14,CDK6,TDP1,CDK5R1,HSD17B10,FUT7,CA2
Serous cystadenoma,borderline malignancy of ovary
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C73.4
 CSNK2A3,CSNK2A1,ALOX12,TDP1,APEX1,FUT7,CA2
Solid tumour/cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00-2F9Z
 CDK6,CA14,APEX1,CA2,GSK3B,CSNK2A1
Malignant neoplasms of biliary tract, distal bile duct
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C15
 CSNK2A3,CSNK2A1,ALOX12,CDK5R1,LMNA,CCNB2
Adenocarcinoma of pancreas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C10.0
 CA14,CDK5R1,ACHE,FUT7,LMNA,CA2
Mesothelioma of pleura
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C26.0
 CDK6,TDP1,APEX1,FUT7,LMNA,CSNK2A2
Pheochromocytoma
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH3854
 CA14,CDK5R1,ACHE,FUT7,CA2
Cytomegaloviral disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D82
 CA14,CDK5R1,ACHE,KDM4E,CA2
Malignant neoplasms of thymus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C27
 CDK5R1,APEX1,HSD17B10,ACHE,FUT7
Germ cell tumour of testis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C80.2
 CA14,CDK6,ALOX12,ACHE,FUT7
Other specified malignant neoplasms of kidney, except renal pelvis
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C90.Y
 CCNB2,ACHE,FUT7,CCNB2
Breast cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C60-2C6Y
 CA2,CDK6,CA14
Osteoarthritis of knee
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA01
 NCT04210986,NCT04770064,NCT04815902
COVID-19
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D6Y
 NCT04771611,NCT04537299,NCT04476953
Hepatoblastoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.01
 CDK6,CDK5R1,CCNB2
Squamous cell carcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.2
 CDK5R1,CCNB2,ALOX12
Hepatocellular carcinoma of liver
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12.02
 CDK5R1,CCNB2,CCNB2
Superficial ovarian endometriosis
Disease Category: 16.Diseases of the genitourinary system
Disease ICD-11 Code: GA10.B4
 LMNA,CA2,ACHE
Adenocarcinoma of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.0
 CDK5R1,CCNB2,ACHE
Glioblastoma of brain
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00.00
 CSNK2A3,LMNA,CA2
Renal cell carcinoma, chromophobe type
Disease Category: X.Extension Codes
Disease ICD-11 Code: XH6153
 CDK5R1,CCNB2,CA2
Bacterial infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1A00-1C4Z
 CA2,CA14
Parkinsonism
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A00
 ACHE,GSK3B
Glaucoma
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9C61
 CA2,ACHE
Carpal tunnel syndrome
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C10.0
 FUT7
 NCT05416515
Adenocarcinoma of stomach
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B72.0
 CDK6,CCNB2
Melanoma of skin
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C30
 FUT7,CDK6
Malignant neoplasms of oesophagus
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B70
 CCNB2,ACHE
Urothelial carcinoma of bladder
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C94.2
 CA2,CCNB2
Malignant neoplasms of corpus uteri, unspecified
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C76.Z
 CA2,CCNB2
Polycystic ovary syndrome
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5A80.1
 FUT7,CDK6
Invasive carcinoma of breast
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C61
 FUT7,CCNB2
Malignant neoplasms of adrenal gland
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D11
 FUT7,CCNB2
Diffuse large B-cell lymphomas
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A81
 CDK6,CSNK2A1,TDP1,CDK5R1,APEX1,HSD17B10,ACHE,LMNA,CCNB2,CSNK2A2
Dementia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D80-6D8Z
 ACHE
Oesophageal/gastroduodenal disorder
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DD90
 ACHE
Ocular cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D00-2D07
 APEX1
Myeloproliferative neoplasm
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A20
 GSK3B
Substance abuse
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6C40
 ACHE
Inborn metabolism deficiency
Disease Category: 05.Endocrine, nutritional or metabolic diseases
Disease ICD-11 Code: 5C50-5C59
 CA14
Coronavirus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D92
 CSNK2A1
Mild neurocognitive disorder
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6D71
 ACHE
Essential hypertension
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BA00
 CA2
Insomnia
Disease Category: 07.Sleep-wake disorders
Disease ICD-11 Code: 7A00-7A0Z
 CA2
Seborrhoeic dermatitis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA81
 CA2
Low bone mass disorder
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FB83
 CA2
Osteosarcoma
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2B51
 GSK3B
Retinopathy
Disease Category: 09.Diseases of the visual system
Disease ICD-11 Code: 9B71
 APEX1
Myasthenia gravis
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C6Y
 ACHE
Unspecific substance harmful effect
Disease Category: 22.Injury, poisoning or certain other consequences of external causes
Disease ICD-11 Code: NE6Z
 ACHE
Acute myeloid leukaemia
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A60
 GSK3B
Heart failure
Disease Category: 11.Diseases of the circulatory system
Disease ICD-11 Code: BD10-BD1Z
 CA2
Brain cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2A00
 CDK6
Fragile X chromosome
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LD55
 GSK3B
Duodenal ulcer
Disease Category: 13.Diseases of the digestive system
Disease ICD-11 Code: DA63
 CA2
Lung cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25
 CDK6
Alzheimer disease
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8A20
 ACHE
Psoriasis
Disease Category: 14.Diseases of the skin
Disease ICD-11 Code: EA90
 CDK6
Pediculosis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1G00
 ACHE
Liver cancer
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C12
 CSNK2A1
Myotonic disorder
Disease Category: 08.Diseases of the nervous system
Disease ICD-11 Code: 8C71
 GSK3B
Pain, unspecified
Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified
Disease ICD-11 Code: MG3Z
 ACHE
Schizophrenia
Disease Category: 06.Mental, behavioural or neurodevelopmental disorders
Disease ICD-11 Code: 6A20
 CDK6
Rheumatoid arthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA20
 CA2
Parasitic worm infestation
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F90
 ACHE
Unspecified malignant neoplasms of unspecified sites
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2D4Z
 NCT04733534
Severe acute respiratory syndrome
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D65
 NCT04537299
Osteoarthritis
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA00-FA05
 NCT05276895
Zika virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D48
 ACHE
Osteoarthritis, unspecified
Disease Category: 15.Diseases of the musculoskeletal system or connective tissue
Disease ICD-11 Code: FA0Z
 CDK6
Leishmaniasis
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1F54
 FUT7
West Nile virus infection
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D46
 ACHE
Tetralogy of Fallot
Disease Category: 20.Developmental anomalies
Disease ICD-11 Code: LA88.2
 CA14
Other specified malignant neoplasms of bronchus or lung
Disease Category: 02.Neoplasms
Disease ICD-11 Code: 2C25.Y
 CCNB2
Systemic lupus erythematosus
Disease Category: 04.Diseases of the immune system
Disease ICD-11 Code: 4A40.0
 ACHE
Chikungunya virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D40
 LMNA
Ebola virus disease
Disease Category: 01.Certain infectious or parasitic diseases
Disease ICD-11 Code: 1D60.01
 ACHE

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network 
Data Section
Select to Download
1. General Info & Plant Usage & Geographical Distribution  
2. Plant Ingredients  
3. Collective Molecular Proteins  
4. Collective Enriched Activities  
5. Plant molecular targets overlapping with DEGs  
6. Associated clinical trials  
7. Associated Human Diseases  
>> Targets derived from weak experimental activities
About Us

The CMAUP database is developed by the Bioinformatics & Drug Design group (BIDD) and School of Pharmacy, Fudan University.

CMAUP

Home

About

Browse

Help

Useful links

BIDD home

NPASS database

TCM-ID database

TTD database

Contact

826 Zhangheng Road, Pudong New District, Shanghai, China

Principle Investigator:
Prof. Chen Yu Zong
chenyuzong@sz.tsinghua.edu.cn
Prof. Zeng Xian
zengxian@fudan.edu.cn

Developer & Maintainer:
Ph.D. Student Dongyue Hou
dyhou22@m.fudan.edu.cn
Mr. Hanbo Lin
hblin19@fudan.edu.cn
Ms. Yuhan Feng
yhfeng22@m.fudan.edu.cn

© 2023 Copyright: Bioinformatics & Drug Design group