• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Melochia Corchorifolia


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GTCGAACCTGCCTAGCAGAACGACCCGCGGACGCGTTAACAACACAACGGGGGGAGGAGGCGGCCTCGGCCCCGAGCCCCCCCGGGTCGGCGGCGCGCGAGCGCCCCCGGCCAACGAACGAACCCCGGCGCGAATTGCGCCAAGGAATTGCAAAAGGAAAAGAGGAGGCTCGGCGTCCCCGTTCGCGGGCGACGCGGGCTATCCTCGATTCACAACAACACACTAGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCATTAGGCCGAGGGCTCGTTTGCCTGGGTGTCACGTATCGTCGCCCCAACCCAAACCGACCCATGTGGCGGAGGGCGGGGCGGAAACTGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCGAAACACGAGTCCCAGGCGTCCCGAGCGCCGCGACGATCGGTGGTGTATGCTCATGCTCGTCGCGAGTCGCGCGCGCCGGACGCCCCCAGGGATGCCTCGAGACCCTGCTGCGTCCCCCCGAGGACGCTCGCATCGCGACCCCAGGTCAGGCGG

Click for details-----ITS1

TCGAAACCTGCCTAGCAGAACGACCCGCGGACGCGTTAACAACACAACGGGGGGAGGAGGCGGCCTCGGCCCCGAGCCCCCCCGGGTCGGCGGCGCGCGAGCGCCCCCGGCCAACGAACGAACCCCGGCGCGAATTGCGCCAAGGAATTGCAAAAGGAAAAGAGGAGGCTCGGCGTCCCCGTTCGCGGGCGACGCGGGCTATCCTCGATTCACAACAACACACTAGAA

Click for details-----ITS2

ATCGTCGCCCCAACCCAAACCGACCCATGTGGCGGAGGGCGGGGCGGAAACTGGCCTCCCGTGCGCTCCCCGCTCGCGGCTGGCCGAAACACGAGTCCCAGGCGTCCCGAGCGCCGCGACGATCGGTGGTGTATGCTCATGCTCGTCGCGAGTCGCGCGCGCCGGACGCCCCCAGGGATGCCTCGAGACCCTGCTGCGTCCCCCCGAGGACGCTCGCATCGCGACCCCAGGTCAGGCGG
Taxonomic Information

Plant ID: NPO2423
Plant Latin Name: Melochia Corchorifolia
Taxonomy Genus: Melochia
Taxonomy Family: Malvaceae

Plant External Links:

NCBI TaxonomyDB: 133573
Plant-of-the-World-Online: 824444-1

Used in Medicines

Country/Region:
Tanzania; Indonesia; India; Malaysia; Rwanda; Vietnam; Thailand; Kenya; Philippines

Traditional Medicine System:
Indian Folk; Siddha

Geographical Distribution

Madagascar; Bangladesh; Mauritania; Sudan; Guinea; Malawi; Ethiopia; Rwanda; Tanzania; Somalia; Nigeria; Cameroon; Cote d'Ivoire; Benin; Ghana; Zambia; Burkina Faso; Togo; Zimbabwe; China; Thailand; Sierra Leone; Liberia; Gambia; Philippines; Indonesia; Mauritius; Vietnam; Gabon; Guinea-Bissau; Mali; Taiwan; United States; Angola; Chad; South Africa; India; Malaysia; Senegal; Congo; Mozambique; Uganda; Burundi; Kenya; Niger; Fiji; Botswana

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

15 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


10 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

5 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9600

Ingredient ID: NPC53954

Ingredient ID: NPC42264

Ingredient ID: NPC299856

Ingredient ID: NPC259205

Ingredient ID: NPC253410

Ingredient ID: NPC202551

Ingredient ID: NPC197596

Ingredient ID: NPC179950

Ingredient ID: NPC179403

Ingredient ID: NPC17810

Ingredient ID: NPC159362

Ingredient ID: NPC133671

Ingredient ID: NPC12343

Ingredient ID: NPC116717