CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Curcuma Longa

Example Image

PLANiTS DNA barcode

Click for details-----ITS

CCTTGCTCCCCCCAAGGGGAGGGCCCTTGCTCCCAATTTTTTTCGTTGTTCCATCCCACTTGTTAGTCCATCCACCCACCCACCCGGGCGGGGGGAAAGAAAGGTCCCCTCCACACGTAACCAATCCTCCCTCCCTTTTTTGATGTCTCTCAACATCTTTCCTTCTGTAGACGTACCTGCGGATGCATCAGGGCAGAGAAAACATCATAAAATGATGGATGATTGTGAACGTGTGAAAGTGACCCTTTAGTCATCAGCCCGCCCATGTTGGTGGGCGATTGACCGTAGCTCGGTGCGATCGGCACTAAGGAACAACGAACTTGGAAGCAGAGGGCCCCTCAGCGCGAGCCGCGAGCCCAATGCGTCGGAGATTCTTCGGAATCAAACGACTCTCGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAATGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAATGCAAGTTGCGCCCGAGGCCATTAGGTCGAGGGCACGTCTGCCTGGGCGTCACACCATCGTCGCTTTTGCTCCATGCTTTGTCGGCATTGAGCGCGGAAGTTGGCCCCGTGTGCCCTCTCGGGCACAGTCGGTCGAAGAGCGGGTACTCGGTAATCGTCGAGCGGATGGACGTTGGTCGTCGCGAGCGAAAATGAACGTCGTCTCGTAATTTTGGGATGAGCCCTCAATCAAGCGACCGTGTGTGATTGATGATTGCGGAGCCGCGAGAAAGCGCCGCGTCAATCGATGTGCGGACCCC

Click for details-----ITS1

Click for details-----ITS2

CATCGTCGCTTTTGCTCCATGCTTTGTCGGCATTGAGCGCGGAAGTTGGCCCCGTGTGCCCTCTCGGGCACAGTCGGTCGAAGAGCGGGTAGTCGGTAATCGTCCAGCACGATGGACGTTGGTCGTCGCGAGCGAGAACTGAACGTCGTCCTCGTCGTTTTGGGATGAGCCCTCAATAAGAGACCCTGTGTGATTGATGATTGCGGACTCGCCCGAAAGCGCCCCGTCAATCATTTGCGGGCCCAAGT

Taxonomic Information

Plant ID: NPO24124
Plant Latin Name: Curcuma Longa
Taxonomy Genus: Curcuma
Taxonomy Family: Zingiberaceae

Plant External Links:

NCBI TaxonomyDB: 136217
Plant-of-the-World-Online: 796451-1

Used in Medicines

Country/Region:

Thailand; Indonesia; India; China

Traditional Medicine System:

Sowa-Rigpa; Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Geographical Distribution

Bangladesh; Costa Rica; Cambodia; Cote d'Ivoire; Australia; Cuba; China; Thailand; Haiti; Belize; Philippines; Indonesia; New Caledonia; Mauritius; Trinidad and Tobago; Vietnam; Guinea-Bissau; Dominican Republic; United States; Myanmar; India; Congo; Sri Lanka; Taiwan; Fiji

Geographical Distribution

−

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 2	CYP2B6	Cytochrome P450 2B6	P20813	CHEMBL4729
Drug Transporter	SLC superfamily of solute carriers	SLCO1B3	Solute carrier organic anion transporter family member 1B3	Q9NPD5	CHEMBL1743121
Drug Transporter	SLC superfamily of solute carriers	SLC6A4	Serotonin transporter	P31645	CHEMBL228
Drug Transporter	SLC superfamily of solute carriers	SLCO1B1	Solute carrier organic anion transporter family member 1B1	Q9Y6L6	CHEMBL1697668
Drug Transporter	SLC superfamily of solute carriers	SLC6A2	Norepinephrine transporter	P23975	CHEMBL222
Drug Transporter	SLC superfamily of solute carriers	SLC6A3	Dopamine transporter	Q01959	CHEMBL238
Therapeutic Target	Cysteine protease	CASP6	Caspase-6	P55212	CHEMBL3308
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236

Clinical trials type	Number of clinical trials
NP level	2614
Plant level	33

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00000161	Randomized Trials of Vitamin Supplements and Eye Disease	cataract;macular degeneration	Ascorbate (NPC187770)	NP level
NCT00000461	Harvard Atherosclerosis Reversibility Project (HARP)	Myocardial Ischemia	Niacin (NPC167400)	NP level
NCT00000482	Coronary Drug Project	Myocardial Ischemia;myocardial infarction	Niacin (NPC167400)	NP level
NCT00000512	Familial Atherosclerosis Treatment Study	Myocardial Ischemia	Niacin (NPC167400)	NP level
NCT00000541	Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS)	Myocardial Ischemia	Ascorbate (NPC187770)	NP level
NCT00000541	Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS)	myocardial infarction	Folic Acid (NPC147983);Ascorbate (NPC187770);Pyridoxine (NPC269919)	NP level
NCT00000541	Women's Antioxidant and Folic Acid Cardiovascular Study (WAFACS)	Myocardial Ischemia	Folic Acid (NPC147983);Pyridoxine (NPC269919)	NP level
NCT00000553	HDL-Atherosclerosis Treatment Study (HATS)	Myocardial Ischemia	Niacin (NPC167400)	NP level
NCT00000555	Women's Angiographic Vitamin and Estrogen Trial (WAVE)	menopause;Myocardial Ischemia	Ascorbate (NPC187770)	NP level
NCT00000599	Cholesterol-Lowering Atherosclerosis Study (CLAS)	carotid artery disease;cerebral atherosclerosis;Myocardial Ischemia	Niacin (NPC167400)	NP level

Associated Disease of the Plant	Association Type & Detailed Evidence
Acne vulgaris Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED80	MMP2,ESR1 NCT03522922
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA
Acquired prion disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E01	ESR1
Actinic keratosis Disease Category: X.Extension Codes Disease ICD-11 Code: XH36H6	NCT03083470
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AURKB,FFAR1,AKR1B1,KDR,HSD11B1,PPARA,NR3C1
Acute ischaemic heart disease, unspecified Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA4Z	NCT00855257
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	TOP2A,PIM1,NFKB1,AXL,FLT3,TP53,SRC,AURKB NCT00329498,NCT02472626,NCT00184054
Acute pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG31	SLC6A2
Acute promyelocytic leukaemia Disease Category: X.Extension Codes Disease ICD-11 Code: XH1A50	NCT03624270
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3 NCT04404387,NCT03718507

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Curcuma Longa

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

517 All known Ingredients in Total

434 Ingredients with Acceptable Bioavailablity

232 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acne vulgaris

Acquired hypomelanotic disorder

Acquired prion disease

Actinic keratosis

Acute diabete complication

Acute ischaemic heart disease, unspecified

Acute myeloid leukaemia

Acute pain

Acute promyelocytic leukaemia

Acute respiratory distress syndrome

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities