• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Artemisia Iwayomogi


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGAACCCTGCAAAGCAGAACGACCCGTGAACGCGTGAAAACAACTGAGTGTCGTTAGGATCAAGCGCTCGTTTGATCCTCTCGACGCTCTGCCGATGTGCATTCACTCGAGTTCTTTTTGACCTTGAGTGAATGTGTCATTGGCGCATTAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTCTTCATGTTGCCCCCGTTCGCGGTGTGCTCATGGGATGCGGCTTCTTTATAATCACAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCTCACAAAGCCTTTTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCCACAATTCTCCGTCAGGGGAGCTCGTGTTTTGGGGGCGGATAATGGTCTCCCGTGCTCATGGCGCGGTTGGCCGAAATAGGAGTCCCTTCGATGGACGCACGAACTAGTGGTGGTCGTAAAAACCCTCGTCTTTTGTTTCGTGCCGTTAGTCGCGAGGGAAGCTCTAAGAAAACCCCAACGTGTCGTCTCTTGACGGCGCTTCGA

Click for details-----ITS1

TCGAACCCTGCAAAGCAGAACGACCCGTGAACGCGTGAAAACAACTGAGTGTCGTTAGGATCAAGCGCTCGTTTGATCCTCTCGACGCTCTGCCGATGTGCATTCACTCGAGTTCTTTTTGACCTTGAGTGAATGTGTCATTGGCGCATTAACAACCCCCGGCACAATGTGTGCCAAGGAAAACTAAACTCAAGAAGGCTCGTCTTCATGTTGCCCCCGTTCGCGGTGTGCTCATGGGATGCGGCTTCTTTATAATCACAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO24105
Plant Latin Name: Artemisia Iwayomogi
Taxonomy Genus: Artemisia
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 265784
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

98 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


53 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

36 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC99643

Ingredient ID: NPC96630

Ingredient ID: NPC96361

Ingredient ID: NPC96294

Ingredient ID: NPC95412

Ingredient ID: NPC94454

Ingredient ID: NPC93746

Ingredient ID: NPC92778

Ingredient ID: NPC89069

Ingredient ID: NPC85728

Ingredient ID: NPC83508

Ingredient ID: NPC83241

Ingredient ID: NPC76336

Ingredient ID: NPC75158

Ingredient ID: NPC74306

Ingredient ID: NPC73436

Ingredient ID: NPC72678

Ingredient ID: NPC70754

Ingredient ID: NPC63458

Ingredient ID: NPC60063

Ingredient ID: NPC55066

Ingredient ID: NPC54264

Ingredient ID: NPC478668

Ingredient ID: NPC46828

Ingredient ID: NPC44751

Ingredient ID: NPC44742

Ingredient ID: NPC40249

Ingredient ID: NPC37825

Ingredient ID: NPC33509

Ingredient ID: NPC326796

Ingredient ID: NPC311043

Ingredient ID: NPC308218

Ingredient ID: NPC305034

Ingredient ID: NPC304246

Ingredient ID: NPC302857

Ingredient ID: NPC297517

Ingredient ID: NPC294902

Ingredient ID: NPC294136

Ingredient ID: NPC287331

Ingredient ID: NPC284731

Ingredient ID: NPC283655

Ingredient ID: NPC267102

Ingredient ID: NPC264763

Ingredient ID: NPC254100

Ingredient ID: NPC2496

Ingredient ID: NPC248128

Ingredient ID: NPC247686

Ingredient ID: NPC242417

Ingredient ID: NPC239913

Ingredient ID: NPC234133

Ingredient ID: NPC231738

Ingredient ID: NPC227670

Ingredient ID: NPC224389

Ingredient ID: NPC222151

Ingredient ID: NPC216908

Ingredient ID: NPC214721

Ingredient ID: NPC210040

Ingredient ID: NPC209275

Ingredient ID: NPC208740

Ingredient ID: NPC207656

Ingredient ID: NPC205014

Ingredient ID: NPC198561

Ingredient ID: NPC196490

Ingredient ID: NPC194414

Ingredient ID: NPC189036

Ingredient ID: NPC187488

Ingredient ID: NPC181610

Ingredient ID: NPC180684

Ingredient ID: NPC179950

Ingredient ID: NPC179438

Ingredient ID: NPC178223

Ingredient ID: NPC176740

Ingredient ID: NPC174486

Ingredient ID: NPC173996

Ingredient ID: NPC171327

Ingredient ID: NPC17066

Ingredient ID: NPC169656

Ingredient ID: NPC167976

Ingredient ID: NPC166894

Ingredient ID: NPC166575

Ingredient ID: NPC166362

Ingredient ID: NPC154923

Ingredient ID: NPC154662

Ingredient ID: NPC14682

Ingredient ID: NPC141777

Ingredient ID: NPC138686

Ingredient ID: NPC137453

Ingredient ID: NPC13648

Ingredient ID: NPC136181

Ingredient ID: NPC131981

Ingredient ID: NPC125062

Ingredient ID: NPC124370

Ingredient ID: NPC124173

Ingredient ID: NPC1148

Ingredient ID: NPC109813

Ingredient ID: NPC1075

Ingredient ID: NPC105451

Ingredient ID: NPC102149