• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Casimiroa Edulis


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGAACCCTGCCTAGCAGAACGACCCGTGAACTAGTGAAATCACCGGTGGGGGGTGCGCTCCATGGGCGCTCCTCCCCCTATCGTCGCGGGTGTGGGGCTTGTCCCGCTCCCCGTGGCGAAACAACGAACCCCCGGCGCGGACTGCGCCAAGGAAATCTAACGAGAGAGCACGCTCTTGGGGCCCCAGACACGGTGTGCCTACAGGACGCGGCGCCTTCTTTCACTTTATCTATAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO24038
Plant Latin Name: Casimiroa Edulis
Taxonomy Genus: Casimiroa
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 68535
Plant-of-the-World-Online: 771774-1

Used in Medicines

Country/Region:
China

Traditional Medicine System:
TCM

Geographical Distribution

Honduras; Mexico; El Salvador; Costa Rica; Trinidad and Tobago; Guatemala; China; Nicaragua

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

42 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


42 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

19 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95981

Ingredient ID: NPC93653

Ingredient ID: NPC88173

Ingredient ID: NPC76336

Ingredient ID: NPC74539

Ingredient ID: NPC61274

Ingredient ID: NPC45084

Ingredient ID: NPC42591

Ingredient ID: NPC34770

Ingredient ID: NPC31557

Ingredient ID: NPC31504

Ingredient ID: NPC308763

Ingredient ID: NPC299582

Ingredient ID: NPC297423

Ingredient ID: NPC287152

Ingredient ID: NPC281835

Ingredient ID: NPC263265

Ingredient ID: NPC258298

Ingredient ID: NPC257490

Ingredient ID: NPC250476

Ingredient ID: NPC23610

Ingredient ID: NPC234536

Ingredient ID: NPC23387

Ingredient ID: NPC231890

Ingredient ID: NPC214919

Ingredient ID: NPC210460

Ingredient ID: NPC209712

Ingredient ID: NPC203950

Ingredient ID: NPC189095

Ingredient ID: NPC155498

Ingredient ID: NPC153690

Ingredient ID: NPC145729

Ingredient ID: NPC144416

Ingredient ID: NPC138805

Ingredient ID: NPC137157

Ingredient ID: NPC131885

Ingredient ID: NPC123353

Ingredient ID: NPC120942

Ingredient ID: NPC118418

Ingredient ID: NPC113549

Ingredient ID: NPC105317

Ingredient ID: NPC100899