• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Psilotum Nudum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCATTGACACACATCTGTGAAACCCGGCGAACTGTGCTCGTTCCCCGCGGGGGCGTGCGGCCCTGCCCGCCCCCGACCCCGCCCGTCTCCTCCCCCTCGCGGGCAGGGACGGCGGTCCGCGTGCCAAACCTTGCGCGGTGCCGCGCGAGAGACCGAGACGAACCGCACGAAAGCCTGAGCGCCTCCCCGGCGGGAGGAGAGCGACGAGAACACAACGACTCTCAGCAACGAATATCTTGGCTCTTGCAACGATGAAGAACGCAACGAAATGCGATACGTAGTGTGAATTGCAGGATTCCGTGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGCGGCTCGTCCAAGGGTATGCCTTCCTGAGCGTCCCCGCCAACGTGCCGCCAGGGCCCCCAGTGGGGGGCCGGGTGGGGGTGGCCATCTGCGTGCGTGTGCCGCTGCGCGGTCGGCTTAAAAGGAGCGGTGCCCCCGTCGGCGGCGAGTCGCAAGGGTGGCCCGTCCCCCCGGGGGGCGGCCGGCTTCCTGCGTCTGCGCCCCGCGTCGGGGGGGCGCCGCGAGCGGAACTCCCGATGTGTGTCCACGTCGCAGACACCTACAGCGGGACCTCAGGTGAGGCAAGG

Click for details-----ITS1

TCATTGACACACATCTGTGAAACCCGGCGAACTGTGCTCGTTCCCCGCGGGGGCGTGCGGCCCTGCCCGCCCCCGACCCCGCCCGTCTCCTCCCCCTCGCGGGCAGGGACGGCGGGCCGCGTGCCAAACCTTGCGCGGTGCCGCGCGAGAGACCGAGACGAACCGCACGAAAGCCTGAGCGCCTCCCCGGCGGGAGGAGAGCGACGAGAACACAA

Click for details-----ITS2

CCAACGTGCCGCCAGGGCCCCCAGTGGGGGGCCGGGTGGGGGTGGCCATCTGCGTGCGTGTGCCGCTGCGCGGTCGGCTTAAAAGGAGCGGTGCCCCCGTCGGCGGCGAGTCGCAAGGGTGGCCCGTCCCCCCGGGGGGCGGCCGGCTTCCTGCGTCTGCGCCCCGCGTCGGGGGGGCGCCGCGAGCGGAACTCCCGATGTGTGTCCACGTCGCAGACACCTACAGCGGGACCTCAGGTGAGGCAAGG
Taxonomic Information

Plant ID: NPO23924
Plant Latin Name: Psilotum Nudum
Taxonomy Genus: Psilotum
Taxonomy Family: Psilotaceae

Plant External Links:

NCBI TaxonomyDB: 3240
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Thailand; China; India

Traditional Medicine System:
Indian Folk; TCM

Geographical Distribution

India; China; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

127 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


74 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

51 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC97191

Ingredient ID: NPC95381

Ingredient ID: NPC90493

Ingredient ID: NPC88043

Ingredient ID: NPC87543

Ingredient ID: NPC85813

Ingredient ID: NPC7965

Ingredient ID: NPC73449

Ingredient ID: NPC71639

Ingredient ID: NPC67508

Ingredient ID: NPC62577

Ingredient ID: NPC62290

Ingredient ID: NPC58967

Ingredient ID: NPC57788

Ingredient ID: NPC55900

Ingredient ID: NPC54321

Ingredient ID: NPC54145

Ingredient ID: NPC51700

Ingredient ID: NPC51146

Ingredient ID: NPC50898

Ingredient ID: NPC49188

Ingredient ID: NPC49168

Ingredient ID: NPC47844

Ingredient ID: NPC43276

Ingredient ID: NPC41163

Ingredient ID: NPC38474

Ingredient ID: NPC3812

Ingredient ID: NPC34429

Ingredient ID: NPC34070

Ingredient ID: NPC33690

Ingredient ID: NPC311082

Ingredient ID: NPC310562

Ingredient ID: NPC307163

Ingredient ID: NPC306418

Ingredient ID: NPC302824

Ingredient ID: NPC301205

Ingredient ID: NPC300520

Ingredient ID: NPC294755

Ingredient ID: NPC294555

Ingredient ID: NPC294548

Ingredient ID: NPC291516

Ingredient ID: NPC288506

Ingredient ID: NPC28779

Ingredient ID: NPC282974

Ingredient ID: NPC282694

Ingredient ID: NPC279451

Ingredient ID: NPC279121

Ingredient ID: NPC27600

Ingredient ID: NPC27532

Ingredient ID: NPC274613

Ingredient ID: NPC27340

Ingredient ID: NPC273326

Ingredient ID: NPC272606

Ingredient ID: NPC268710

Ingredient ID: NPC264317

Ingredient ID: NPC262902

Ingredient ID: NPC260734

Ingredient ID: NPC25601

Ingredient ID: NPC254199

Ingredient ID: NPC249958

Ingredient ID: NPC247237

Ingredient ID: NPC244705

Ingredient ID: NPC244284

Ingredient ID: NPC244181

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC239361

Ingredient ID: NPC237608

Ingredient ID: NPC236709

Ingredient ID: NPC234541

Ingredient ID: NPC230920

Ingredient ID: NPC230301

Ingredient ID: NPC227930

Ingredient ID: NPC22098

Ingredient ID: NPC217396

Ingredient ID: NPC217065

Ingredient ID: NPC21666

Ingredient ID: NPC215242

Ingredient ID: NPC210560

Ingredient ID: NPC206095

Ingredient ID: NPC204649

Ingredient ID: NPC194208

Ingredient ID: NPC1940

Ingredient ID: NPC192744

Ingredient ID: NPC189498

Ingredient ID: NPC189156

Ingredient ID: NPC185690

Ingredient ID: NPC184144

Ingredient ID: NPC181295

Ingredient ID: NPC181225

Ingredient ID: NPC181158

Ingredient ID: NPC178134

Ingredient ID: NPC177463

Ingredient ID: NPC177119

Ingredient ID: NPC176869

Ingredient ID: NPC176740

Ingredient ID: NPC171928

Ingredient ID: NPC169110

Ingredient ID: NPC165651

Ingredient ID: NPC161505

Ingredient ID: NPC154152

Ingredient ID: NPC152638

Ingredient ID: NPC149203

Ingredient ID: NPC145820

Ingredient ID: NPC143799

Ingredient ID: NPC140332

Ingredient ID: NPC139545

Ingredient ID: NPC134581

Ingredient ID: NPC133237

Ingredient ID: NPC129165

Ingredient ID: NPC129088

Ingredient ID: NPC125898

Ingredient ID: NPC125575

Ingredient ID: NPC123965

Ingredient ID: NPC123658

Ingredient ID: NPC119775

Ingredient ID: NPC118004

Ingredient ID: NPC116745

Ingredient ID: NPC115951

Ingredient ID: NPC112688

Ingredient ID: NPC110899

Ingredient ID: NPC108218

Ingredient ID: NPC107075

Ingredient ID: NPC106200

Ingredient ID: NPC10316

Ingredient ID: NPC101580

Ingredient ID: NPC101475