CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Agathosma Bisulca

Example Image

PLANiTS DNA barcode

ATCGTTGCCCCCACTCCATCCCCTTCGGGGGCGTGGGGTGTGGGCGGAGAATGGCCTCCCGGGAGCTCCCCGCTCGCGGTTGGCCTAAATCTGAGTCCTCGGCTATCGGAGTCGCGACAATCGGTGGTGAAAACAAGCCTCTCGAGCTAACGTCGTGCCTCCGAACACCACTATGGGACTCTTCGACCCTGACGCTCCGCGCAAGCGGTGCTCGCT

Taxonomic Information

Plant ID: NPO23885
Plant Latin Name: Agathosma Bisulca
Taxonomy Genus: Agathosma
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 1641041
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC50864

Ingredient ID: NPC257084

Ingredient ID: NPC248029

Ingredient ID: NPC232924

Ingredient ID: NPC210437

Ingredient ID: NPC204131

Ingredient ID: NPC189266

Ingredient ID: NPC16452

Ingredient ID: NPC118804

Ingredient ID: NPC112206

Ingredient ID: NPC106295

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA1A	Alpha-1a adrenergic receptor	P35348	CHEMBL229
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD5	Dopamine D5 receptor	P21918	CHEMBL1850
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD2	Dopamine D2 receptor	P14416	CHEMBL217
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD1	Dopamine D1 receptor	P21728	CHEMBL2056
Therapeutic Target	Small molecule receptor (family A GPCR)	DRD3	Dopamine D3 receptor	P35462	CHEMBL234
Therapeutic Target	Small molecule receptor (family A GPCR)	ADRA1D	Alpha-1d adrenergic receptor	P25100	CHEMBL223
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Surface antigen	F3	Coagulation factor III	P13726	CHEMBL4081

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	2

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT02139761	L-tetrahydropalmatine (l-THP) Treatment for Cocaine Use Disorder	cocaine dependence	Tetrahydropalmatine (NPC210437)	NP level
NCT01631383	Pharmacokinetic and Safety Evaluation of L-tetrahydropalmatine (l-THP) With Cocaine Exposure in People With a History of Cocaine Use	cocaine dependence	Tetrahydropalmatine (NPC210437)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	ADRA1A,DRD2,DRD2,DRD1,ADRA1D
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	ADRA1D,DRD2,F3,DRD3
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	DRD1,DRD3,DRD2
Sexual dysfunction Disease Category: 17.Conditions related to sexual health Disease ICD-11 Code: HA00-HA01	DRD3,ADRA1D,DRD2
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	DRD3,DRD2,DRD1
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	ADRA1A,DRD2,ADRA1D
Allergic/hypersensitivity disorder Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A80-4A8Z	DRD2,DRD5,DRD1
Cocaine use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C45	DRD1 NCT01631383,NCT02139761
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	DRD2,DRD1,LMNA
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	DRD2,DRD1,LMNA
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	LMNA,ADRA1A,F3
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	DRD3,DRD2
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	DRD3,DRD2
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	ADRA1D,DRD2
Gastroduodenal motor/secretory disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA41	DRD3,DRD2
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	F3,DRD2
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	DRD3,DRD2
Bipolar disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60	DRD2,DRD3
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	DRD2,ADRA1D
Attention deficit hyperactivity disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A05	DRD3,DRD2
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	DRD2,DRD3
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	DRD2,DRD1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	DRD3,DRD2
Acute upper respiratory infection Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA07	DRD3,DRD2
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	DRD2,DRD3
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	ADRA1D,ADRA1A
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	DRD3,DRD2
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	DRD3,DRD2
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	DRD5,DRD2
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	DRD5,DRD2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	LMNA,F3
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	DRD5,ADRA1D
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	LMNA,F3
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	DRD2,ADRA1D
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	DRD2,F3
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	DRD2,DRD1
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	DRD2
Tic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A05	DRD1
Insomnia Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7A0Z	DRD2
Cerebral ischaemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B1Z	DRD2
Gangrene Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MC85	DRD2
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	DRD2
Psychoactive substances use disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C4G	DRD3
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	DRD2
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	DRD2
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	DRD1
Breathing abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD11	DRD2
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	DRD2
Hyperaemia Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A61-9B7Y	DRD2
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	DRD2
NA Disease Category: NA Disease ICD-11 Code: NA	DRD2
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	DRD2
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	DRD2
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	DRD2
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	DRD3
Restless legs syndrome Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A80	DRD2
Essential hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00	DRD2
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	DRD2
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ADRA1A
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	DRD2
Itching Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G07	DRD2
Acute respiratory distress syndrome Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB00	F3
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	DRD2
Carcinoid syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B10	DRD2
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	DRD2
Abortion Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA00	DRD1
Faecal incontinence Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: ME07	DRD2
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	DRD2
Hypotension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA20-BA21	DRD2
Endocrine gland neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2F37	DRD2
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	DRD2
Postpartum haemorrhage Disease Category: 18.Pregnancy, childbirth or the puerperium Disease ICD-11 Code: JA43	DRD2
Migraine Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A80	DRD2
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	ADRA1A
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	DRD2
Anxiety Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB24.3	DRD2
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F3
Inborn porphyrin/heme metabolism error Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C58	DRD2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	DRD5
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	DRD3
Idiopathic pulmonary fibrosis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03.4	DRD5
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	DRD1
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	DRD5
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	DRD2
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	F3
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	DRD2
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	ADRA1D
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	LMNA
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	LMNA
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	DRD2
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	DRD1

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Agathosma Bisulca

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

11 All known Ingredients in Total

8 Ingredients with Acceptable Bioavailablity

8 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Pulmonary hypertension

Solid tumour/cancer

Parkinsonism

Sexual dysfunction

Schizophrenia

Pain, unspecified

Allergic/hypersensitivity disorder

Cocaine use disorder

Adenocarcinoma of pancreas

Mesothelioma of pleura

Chikungunya virus disease

Mature T-cell lymphoma

Brain cancer

Heart failure

Gastroduodenal motor/secretory disorder

Pancreatic cancer

Stomach cancer

Bipolar disorder

Glaucoma

Attention deficit hyperactivity disorder

BCR-ABL1-negative chronic myeloid leukaemia

Psychotic disorder

Alzheimer disease

Acute upper respiratory infection

Endometrial cancer

Prostate hyperplasia

Multiple myeloma

Depression

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Malignant neoplasms of biliary tract, distal bile duct

Hepatoblastoma

Diffuse large B-cell lymphomas

Cytomegaloviral disease

Systemic lupus erythematosus

Malignant neoplasms of thymus

Chronic kidney disease

Tic disorder

Insomnia

Cerebral ischaemia

Gangrene

Idiopathic interstitial pneumonitis

Psychoactive substances use disorder

Thyrotoxicosis

Substance abuse

Dementia

Breathing abnormality

Asthma

Hyperaemia

Lung cancer

NA

Choreiform disorder

Nausea/vomiting

General pain disorder

Nasopharyngeal cancer

Restless legs syndrome

Essential hypertension

Pituitary gland disorder

Mild neurocognitive disorder

Intellectual development disorder

Itching

Acute respiratory distress syndrome

Type 2 diabetes mellitus

Carcinoid syndrome