• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Agathosma Bisulca


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

NA

Click for details-----ITS2

ATCGTTGCCCCCACTCCATCCCCTTCGGGGGCGTGGGGTGTGGGCGGAGAATGGCCTCCCGGGAGCTCCCCGCTCGCGGTTGGCCTAAATCTGAGTCCTCGGCTATCGGAGTCGCGACAATCGGTGGTGAAAACAAGCCTCTCGAGCTAACGTCGTGCCTCCGAACACCACTATGGGACTCTTCGACCCTGACGCTCCGCGCAAGCGGTGCTCGCT
Taxonomic Information

Plant ID: NPO23885
Plant Latin Name: Agathosma Bisulca
Taxonomy Genus: Agathosma
Taxonomy Family: Rutaceae

Plant External Links:

NCBI TaxonomyDB: 1641041
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

11 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


8 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

8 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC50864

Ingredient ID: NPC257084

Ingredient ID: NPC248029

Ingredient ID: NPC232924

Ingredient ID: NPC210437

Ingredient ID: NPC204131

Ingredient ID: NPC189266

Ingredient ID: NPC16452

Ingredient ID: NPC118804

Ingredient ID: NPC112206

Ingredient ID: NPC106295