• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Menispermum Canadense


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TCGATACCTGCAGCAGCAGAACGACCCGCGAACCATTGAAACCGTGACTTGTGACTCTCGGGGCGGCTCCCGCAGCCCCCCGATTGAACAACAAACCCCGGCGCGGCACGCGCCAAGGACATCAGAGTGGAACGGACGGCGCGTCCCGGCGGCTAGCCCCCGGGACGAYGCCGGCATTCCGAATTATTGAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCACCAGGTCGAGGGCACGTCTGCCTGGGCGTCACGTGACGCGCCACACCCAACCCCGCGCTAGGGGGGGAGTGGAGATTGGCCTCCCGCGACCAGCGCACGGTTGGCTGAAATGATTCCCCTGGCGTCCCCGAACGACGCGATCAGTGGTGGCAAGCTAATGACGCGATCGGGCGGGCGCCGGAGGGGCACGGTACCCTCGTAAGTACACACC

Click for details-----ITS1

TCGATACCTGCAGCAGCAGAACGACCCGCGAACCATTGAAACCGTGACTTGTGACTCTCGGGGCGGCTCCCGCAGCCCCCCGATTGAACAACAAACCCCGGCGCGGCACGCGCCAAGGACATCAGAGTGGAACGGACGGCGCGTCCCGGCGGCTAGCCCCCGGGACGAYGCCGGCATTCCGAATTATTGAA

Click for details-----ITS2

ATTGCGCCACTCCCAACCCCAATGGTGGGAGTGAAATTGGCCTCCCGTGACTCGTGTGCGGACGGCTGAAAAAGTTGCCTGTCGGTGGCATGCACTACGCGATCAGTGGTGGTTGACAAAACCCATTCACCGAAATAGGATGACGTGATCGAGTAGTTGCCATCGGGGGTAAATTGAACCCTTGTAGCTCATATACC
Taxonomic Information

Plant ID: NPO23791
Plant Latin Name: Menispermum Canadense
Taxonomy Genus: Menispermum
Taxonomy Family: Menispermaceae

Plant External Links:

NCBI TaxonomyDB: 49681
Plant-of-the-World-Online: n.a.

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


7 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

4 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC90623

Ingredient ID: NPC89224

Ingredient ID: NPC72411

Ingredient ID: NPC55432

Ingredient ID: NPC37179

Ingredient ID: NPC317272

Ingredient ID: NPC290598

Ingredient ID: NPC285413

Ingredient ID: NPC23086

Ingredient ID: NPC228099

Ingredient ID: NPC220089

Ingredient ID: NPC178984

Ingredient ID: NPC142415

Ingredient ID: NPC141659