• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Solanum Aculeatissimum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

GGATCATTGTCGAAACCTGCAGAGCAGAACGACCCGCGAACACGTTCAAACACTGGGGGGGCCGCGCGGCGGGGGCGCTTCGGCGCTGCCCCGCGCGTCTCCCCTACGCCCCCGATGCGTGCCTCTGCGCTCGTTCTTGGGGGCCAAAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAATTGAGAGCCCTCCCCCCGCGCCCCGTCCGCGGAGCGTGCGGGTGGATGTGTGCTTCTTTCTGAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTTGCACGCCGCACGGCGTCGCGGGGGCGGATACTGGTCTCCCGTGAGCCTCGAGCCCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAACTCAACTCTCTTGGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGACCCTCCCAGCGCTCAGGCGCTCCGACCGCGACCCCAGGTCA

Click for details-----ITS1

GGATCATTGTCGAAACCTGCAGAGCAGAACGACCCGCGAACACGTTCAAACACTGGGGGGGCCGCGCGGCGGGGGCGCTTCGGCGCTGCCCCGCGCGTCTCCCCTACGCCCCCGATGCGTGCCTCTGCGCTCGTTCTTGGGGGCCAAAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAATTGAGAGCCCTCCCCCCGCGCCCCGTCCGCGGAGCGTGCGGGTGGATGTGTGCTTCTTTCTGAACCAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO23754
Plant Latin Name: Solanum Aculeatissimum
Taxonomy Genus: Solanum
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 267265
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
India

Traditional Medicine System:
Indian Folk; Ayurveda

Geographical Distribution

India

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

102 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

45 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC9683

Ingredient ID: NPC95920

Ingredient ID: NPC92740

Ingredient ID: NPC91415

Ingredient ID: NPC89907

Ingredient ID: NPC88708

Ingredient ID: NPC85488

Ingredient ID: NPC85001

Ingredient ID: NPC82330

Ingredient ID: NPC73738

Ingredient ID: NPC68011

Ingredient ID: NPC65606

Ingredient ID: NPC65004

Ingredient ID: NPC64063

Ingredient ID: NPC60085

Ingredient ID: NPC55830

Ingredient ID: NPC54889

Ingredient ID: NPC53252

Ingredient ID: NPC51328

Ingredient ID: NPC50898

Ingredient ID: NPC50496

Ingredient ID: NPC49074

Ingredient ID: NPC46979

Ingredient ID: NPC41850

Ingredient ID: NPC41844

Ingredient ID: NPC4044

Ingredient ID: NPC40432

Ingredient ID: NPC38591

Ingredient ID: NPC38041

Ingredient ID: NPC37286

Ingredient ID: NPC35741

Ingredient ID: NPC34103

Ingredient ID: NPC311830

Ingredient ID: NPC307050

Ingredient ID: NPC301744

Ingredient ID: NPC300781

Ingredient ID: NPC295286

Ingredient ID: NPC293213

Ingredient ID: NPC289263

Ingredient ID: NPC28497

Ingredient ID: NPC280704

Ingredient ID: NPC279121

Ingredient ID: NPC275950

Ingredient ID: NPC272471

Ingredient ID: NPC271985

Ingredient ID: NPC267291

Ingredient ID: NPC266340

Ingredient ID: NPC264752

Ingredient ID: NPC259150

Ingredient ID: NPC257700

Ingredient ID: NPC256858

Ingredient ID: NPC255674

Ingredient ID: NPC255446

Ingredient ID: NPC253722

Ingredient ID: NPC248132

Ingredient ID: NPC247553

Ingredient ID: NPC247165

Ingredient ID: NPC243702

Ingredient ID: NPC242807

Ingredient ID: NPC240697

Ingredient ID: NPC240343

Ingredient ID: NPC238468

Ingredient ID: NPC234133

Ingredient ID: NPC222004

Ingredient ID: NPC216429

Ingredient ID: NPC211589

Ingredient ID: NPC211476

Ingredient ID: NPC205796

Ingredient ID: NPC203620

Ingredient ID: NPC198388

Ingredient ID: NPC195749

Ingredient ID: NPC193456

Ingredient ID: NPC187998

Ingredient ID: NPC186528

Ingredient ID: NPC18576

Ingredient ID: NPC183950

Ingredient ID: NPC181079

Ingredient ID: NPC18074

Ingredient ID: NPC1786

Ingredient ID: NPC174157

Ingredient ID: NPC173308

Ingredient ID: NPC167425

Ingredient ID: NPC167085

Ingredient ID: NPC166734

Ingredient ID: NPC157378

Ingredient ID: NPC153739

Ingredient ID: NPC15

Ingredient ID: NPC148365

Ingredient ID: NPC147753

Ingredient ID: NPC145930

Ingredient ID: NPC145604

Ingredient ID: NPC143372

Ingredient ID: NPC140175

Ingredient ID: NPC137062

Ingredient ID: NPC132787

Ingredient ID: NPC122164

Ingredient ID: NPC116775

Ingredient ID: NPC115400

Ingredient ID: NPC114240

Ingredient ID: NPC109822

Ingredient ID: NPC107475

Ingredient ID: NPC103409