CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Solanum Aculeatissimum

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GGATCATTGTCGAAACCTGCAGAGCAGAACGACCCGCGAACACGTTCAAACACTGGGGGGGCCGCGCGGCGGGGGCGCTTCGGCGCTGCCCCGCGCGTCTCCCCTACGCCCCCGATGCGTGCCTCTGCGCTCGTTCTTGGGGGCCAAAACGAACCCCGGCGCGGAAAGCGCCAAGGAATACTAAATTGAGAGCCCTCCCCCCGCGCCCCGTCCGCGGAGCGTGCGGGTGGATGTGTGCTTCTTTCTGAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCTTGCACGCCGCACGGCGTCGCGGGGGCGGATACTGGTCTCCCGTGAGCCTCGAGCCCGCGGCTGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCATGTGGTGGTTGTAACTCAACTCTCTTGGTGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCCGACCCTCCCAGCGCTCAGGCGCTCCGACCGCGACCCCAGGTCA

Click for details-----ITS1

Click for details-----ITS2

Taxonomic Information

Plant ID: NPO23754
Plant Latin Name: Solanum Aculeatissimum
Taxonomy Genus: Solanum
Taxonomy Family: Solanaceae

Plant External Links:

NCBI TaxonomyDB: 267265
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

India

Traditional Medicine System:

Indian Folk; Ayurveda

Geographical Distribution

India

Geographical Distribution

−

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

102 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

57 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

45 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC9683

Ingredient ID: NPC95920

Ingredient ID: NPC92740

Ingredient ID: NPC91415

Ingredient ID: NPC89907

Ingredient ID: NPC88708

Ingredient ID: NPC85488

Ingredient ID: NPC85001

Ingredient ID: NPC82330

Ingredient ID: NPC73738

Ingredient ID: NPC68011

Ingredient ID: NPC65606

Ingredient ID: NPC65004

Ingredient ID: NPC64063

Ingredient ID: NPC60085

Ingredient ID: NPC55830

Ingredient ID: NPC54889

Ingredient ID: NPC53252

Ingredient ID: NPC51328

Ingredient ID: NPC50898

Ingredient ID: NPC50496

Ingredient ID: NPC49074

Ingredient ID: NPC46979

Ingredient ID: NPC41850

Ingredient ID: NPC41844

Ingredient ID: NPC4044

Ingredient ID: NPC40432

Ingredient ID: NPC38591

Ingredient ID: NPC38041

Ingredient ID: NPC37286

Ingredient ID: NPC35741

Ingredient ID: NPC34103

Ingredient ID: NPC311830

Ingredient ID: NPC307050

Ingredient ID: NPC301744

Ingredient ID: NPC300781

Ingredient ID: NPC295286

Ingredient ID: NPC293213

Ingredient ID: NPC289263

Ingredient ID: NPC28497

Ingredient ID: NPC280704

Ingredient ID: NPC279121

Ingredient ID: NPC275950

Ingredient ID: NPC272471

Ingredient ID: NPC271985

Ingredient ID: NPC267291

Ingredient ID: NPC266340

Ingredient ID: NPC264752

Ingredient ID: NPC259150

Ingredient ID: NPC257700

Ingredient ID: NPC256858

Ingredient ID: NPC255674

Ingredient ID: NPC255446

Ingredient ID: NPC253722

Ingredient ID: NPC248132

Ingredient ID: NPC247553

Ingredient ID: NPC247165

Ingredient ID: NPC243702

Ingredient ID: NPC242807

Ingredient ID: NPC240697

Ingredient ID: NPC240343

Ingredient ID: NPC238468

Ingredient ID: NPC234133

Ingredient ID: NPC222004

Ingredient ID: NPC216429

Ingredient ID: NPC211589

Ingredient ID: NPC211476

Ingredient ID: NPC205796

Ingredient ID: NPC203620

Ingredient ID: NPC198388

Ingredient ID: NPC195749

Ingredient ID: NPC193456

Ingredient ID: NPC187998

Ingredient ID: NPC186528

Ingredient ID: NPC18576

Ingredient ID: NPC183950

Ingredient ID: NPC181079

Ingredient ID: NPC18074

Ingredient ID: NPC1786

Ingredient ID: NPC174157

Ingredient ID: NPC173308

Ingredient ID: NPC167425

Ingredient ID: NPC167085

Ingredient ID: NPC166734

Ingredient ID: NPC157378

Ingredient ID: NPC153739

Ingredient ID: NPC15

Ingredient ID: NPC148365

Ingredient ID: NPC147753

Ingredient ID: NPC145930

Ingredient ID: NPC145604

Ingredient ID: NPC143372

Ingredient ID: NPC140175

Ingredient ID: NPC137062

Ingredient ID: NPC132787

Ingredient ID: NPC122164

Ingredient ID: NPC116775

Ingredient ID: NPC115400

Ingredient ID: NPC114240

Ingredient ID: NPC109822

Ingredient ID: NPC107475

Ingredient ID: NPC103409

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Show entries

Search:

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Cytochrome P450	Cytochrome P450 family 1	CYP1B1	Cytochrome P450 1B1	Q16678	CHEMBL4878
Cytochrome P450	Cytochrome P450 family 1	CYP1A1	Cytochrome P450 1A1	P04798	CHEMBL2231
Cytochrome P450	Cytochrome P450 family 1	CYP1A2	Cytochrome P450 1A2	P05177	CHEMBL3356
Therapeutic Target	Enzyme	NOX4	NADPH oxidase 4	Q9NPH5	CHEMBL1250375
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Lyase	CA12	Carbonic anhydrase XII	O43570	CHEMBL3242
Therapeutic Target	Lyase	CA7	Carbonic anhydrase VII	P43166	CHEMBL2326
Therapeutic Target	Lyase	CA9	Carbonic anhydrase IX	Q16790	CHEMBL3594
Therapeutic Target	Lyase	CA4	Carbonic anhydrase IV	P22748	CHEMBL3729
Therapeutic Target	Metallo protease	MMP12	Matrix metalloproteinase 12	P39900	CHEMBL4393

Showing 1 to 10 of 22 entries

Previous1 2 3Next

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	1

Clinical trial details

Show entries

Search:

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT01276704	Prevention Strategy for Pre-Menopausal Women at High Risk for Development of Breast Cancer	breast cancer	(+)-Secoisolariciresinol (NPC85488)	NP level

Showing 1 to 1 of 1 entries

Previous1Next

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Show entries

Search:

Associated Disease of the Plant	Association Type & Detailed Evidence
Acquired hypermelanosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED60	TYR
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	TYR
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	DPP4,AKR1B1
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	GSK3B,FLT3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	CA12,CYP2C9,XDH,CA9,MMP12,ACHE,CA7,TTR,THPO
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CYP2C9,DPP4,HSD17B2,XDH,CA9,CISD1,ACHE,CYP1B1,HIF1A,CA7,TTR
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	NOX4,TTR
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	MMP12,NOX4,CYP19A1
Adrenomedullary hyperfunction Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A75	HIF1A
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	ACHE,ESR2,FLT3

Showing 1 to 10 of 145 entries

Previous1 2 3 4 5…15Next

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Solanum Aculeatissimum

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

102 All known Ingredients in Total

57 Ingredients with Acceptable Bioavailablity

45 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Acquired hypermelanosis

Acquired hypomelanotic disorder

Acute diabete complication

Acute myeloid leukaemia

Adenocarcinoma of bronchus or lung

Adenocarcinoma of pancreas

Adenocarcinoma of prostate

Adenocarcinoma of stomach

Adrenomedullary hyperfunction

Alzheimer disease

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

>> Targets derived from weak experimental activities