CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Staehelina Fruticosa

Example Image

PLANiTS DNA barcode

Click for details-----ITS

TCGAAGCCTGCACAGCAGAACGACCCGTGAACATGTAACCTCAATCGGGCACCTAGGTGATCGGACGTAAGCCCAAGATCCTTGATGCCCTGCTGACGTACATGCATGTTGCCTCTCTGAGGCGTTGTGGATGTTACGTTGGCAAGAAAACAAACCCCGGCACGGAATGTGCCAAGGAGAACAAAACTTTAGAAGGGCGTGCCCTATGTTGCCCCGTTTACGGTGTGCGCATGGGTCGTGGCCTCTCATTAACCATAAACGACTCTCGGCAACGGATATCTCGGCTCACGCATCGATGAAGAACGTAGCAAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGTGTCGCCCCCGACCCCGCCTCCTTTGGGGGTGGGTTTCGTTGGGGGCGGAGACTGGTCTCCCATGCCTATGGTGTGGTTGGCCTAAACAAGAGTCCTCCTCGGCAGACGCACGGCTAGTGGTGGTTGTCAAGGCCTTAGTCTCGAGCCGTGCGTCGTTTGCTGAAGTGAAACGCTCTCTAAAGACCCCAACGCGTCGTCTTGCGATGATGCTTCGA

Click for details-----ITS1

Click for details-----ITS2

ATCGTGTCGCCCCCGACCCCGCCTCCTTTGGGGGTGGGTTTCGTTGGGGGCGGAGACTGGTCTCCCATGCCTATGGTGTGGTTGGCCTAAACAAGAGTCCTCCTCGGCAGACGCACGGCTAGTGGTGGTTGTCAAGGCCTTAGTCTCGAGCCGTGCGTCGTTTGCTGAAGTGAAACGCTCTCTAAAGACCCCAACGCGTCGTCTTGCGATGATGCTTCGA

Taxonomic Information

Plant ID: NPO23739
Plant Latin Name: Staehelina Fruticosa
Taxonomy Genus: Staehelina
Taxonomy Family: Asteraceae

Plant External Links:

NCBI TaxonomyDB: 313546
Plant-of-the-World-Online: n.a.

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

45 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

34 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

31 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC85813

Ingredient ID: NPC71639

Ingredient ID: NPC67508

Ingredient ID: NPC62290

Ingredient ID: NPC57788

Ingredient ID: NPC54321

Ingredient ID: NPC54145

Ingredient ID: NPC51700

Ingredient ID: NPC49168

Ingredient ID: NPC47844

Ingredient ID: NPC43276

Ingredient ID: NPC41163

Ingredient ID: NPC34429

Ingredient ID: NPC310562

Ingredient ID: NPC282974

Ingredient ID: NPC282694

Ingredient ID: NPC27532

Ingredient ID: NPC274613

Ingredient ID: NPC273326

Ingredient ID: NPC264317

Ingredient ID: NPC254199

Ingredient ID: NPC244705

Ingredient ID: NPC243728

Ingredient ID: NPC242580

Ingredient ID: NPC230920

Ingredient ID: NPC230301

Ingredient ID: NPC22098

Ingredient ID: NPC215242

Ingredient ID: NPC210560

Ingredient ID: NPC194208

Ingredient ID: NPC1940

Ingredient ID: NPC192744

Ingredient ID: NPC181225

Ingredient ID: NPC178134

Ingredient ID: NPC176869

Ingredient ID: NPC171928

Ingredient ID: NPC165651

Ingredient ID: NPC149203

Ingredient ID: NPC143799

Ingredient ID: NPC125575

Ingredient ID: NPC123965

Ingredient ID: NPC123658

Ingredient ID: NPC110899

Ingredient ID: NPC106200

Ingredient ID: NPC101475

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Enzyme	HPGD	15-hydroxyprostaglandin dehydrogenase [NAD+]	P15428	CHEMBL1293255
Therapeutic Target	Enzyme	RECQL	ATP-dependent DNA helicase Q1	P46063	CHEMBL1293236
Therapeutic Target	Enzyme	POLB	DNA polymerase beta	P06746	CHEMBL2392
Therapeutic Target	Enzyme	CES1	Acyl coenzyme A:cholesterol acyltransferase	P23141	CHEMBL2265
Therapeutic Target	Enzyme	APEX1	DNA-(apurinic or apyrimidinic site) lyase	P27695	CHEMBL5619
Therapeutic Target	Enzyme	AKR1C3	Aldo-keto-reductase family 1 member C3	P42330	CHEMBL4681
Therapeutic Target	Hydrolase	ACHE	Acetylcholinesterase	P22303	CHEMBL220
Therapeutic Target	Nuclear hormone receptor subfamily 1	NR1H4	Bile acid receptor FXR	Q96RI1	CHEMBL2047
Therapeutic Target	Nuclear hormone receptor subfamily 1	RORC	Nuclear receptor ROR-gamma	P51449	CHEMBL1741186
Therapeutic Target	Other cytosolic protein	HSPA1A	Heat shock 70 kDa protein 1	P0DMV8	CHEMBL5460
Therapeutic Target	Oxidoreductase	ALOX15	Arachidonate 15-lipoxygenase	P16050	CHEMBL2903
Therapeutic Target	Oxidoreductase	MAOA	Monoamine oxidase A	P21397	CHEMBL1951
Therapeutic Target	Oxidoreductase	AKR1B1	Aldose reductase	P15121	CHEMBL1900
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Therapeutic Target	Protein Kinase	EGFR	Epidermal growth factor receptor erbB1	P00533	CHEMBL203
Therapeutic Target	Protein Kinase	INSR	Insulin receptor	P06213	CHEMBL1981
Therapeutic Target	Protein Kinase	CSNK2A1	Casein kinase II alpha	P68400	CHEMBL3629
Therapeutic Target	Protein Kinase	IGF1R	Insulin-like growth factor I receptor	P08069	CHEMBL1957
Therapeutic Target	Protein Kinase	TEK	Tyrosine-protein kinase TIE-2	Q02763	CHEMBL4128
Therapeutic Target	Protein Kinase	MET	Hepatocyte growth factor receptor	P08581	CHEMBL3717
Therapeutic Target	Protein Kinase	SRC	Tyrosine-protein kinase SRC	P12931	CHEMBL267
Therapeutic Target	Protein Kinase	NUAK1	NUAK family SNF1-like kinase 1	O60285	CHEMBL5784
Therapeutic Target	Protein Kinase	KDR	Vascular endothelial growth factor receptor 2	P35968	CHEMBL279
Drug Transporter	SLC superfamily of solute carriers	SLC22A6	Solute carrier family 22 member 6	Q4U2R8	CHEMBL1641347
Therapeutic Target	Small molecule receptor (family A GPCR)	GPR35	G-protein coupled receptor 35	Q9HC97	CHEMBL1293267
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR4	G-protein coupled receptor 120	Q5NUL3	CHEMBL5339
Therapeutic Target	Small molecule receptor (family A GPCR)	FFAR1	Free fatty acid receptor 1	O14842	CHEMBL4422
Therapeutic Target	Structural protein	LMNA	Prelamin-A/C	P02545	CHEMBL1293235
Therapeutic Target	Transcription factor	RELA	Nuclear factor NF-kappa-B p65 subunit	Q04206	CHEMBL5533
Therapeutic Target	Transcription factor	SMAD3	Mothers against decapentaplegic homolog 3	P84022	CHEMBL1293258
Therapeutic Target	Transferase	POLI	DNA polymerase iota	Q9UNA4	CHEMBL5391
Therapeutic Target	Transferase	POLH	DNA polymerase eta	Q9Y253	CHEMBL5542
Therapeutic Target	Transferase	GSTP1	Glutathione S-transferase Pi	P09211	CHEMBL3902

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	13

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT00951158	A Molecular Pharmacodynamic Dose-titration Trial of Conjugated Linoleic Acid (CLA; Clarinol®) in Patients With Advanced Solid Tumors	neoplasm	Linoleic Acid (NPC85813)	NP level
NCT00908791	Proof of Principle Trial to Determine if Nutritional Supplement Conjugated Linoleic Acid (CLA) Can Modulate the Lipogenic Pathway in Breast Cancer Tissue	breast cancer	Linoleic Acid (NPC85813)	NP level
NCT04403568	Testing the Synergism of Phytonutrients, Curcumin and Ursolic Acid, to Target Molecular Pathways in the Prostate	prostate cancer	Ursolic Acid (NPC51700)	NP level
NCT00607945	Dietary Fatty Acids as Complementary Therapy in Type 2 Diabetes Mellitus	type 2 diabetes mellitus	Linoleic Acid (NPC85813)	NP level
NCT04011618	Effect of Ellagic Ácid on the Components of Metabolic Syndrome, Insulin Sensitivity and Insulin Secretion	metabolic syndrome	Ellagic Acid (NPC178134)	NP level
NCT03216876	A Study Of Ursolic Acid For Primary Sclerosing Cholangitis	sclerosing cholangitis	Ursolic Acid (NPC51700)	NP level
NCT00701987	Safety, Tolerability, and Preliminary Efficacy Study of ALS-357 in Patients With Cutaneous Metastatic Melanoma	melanoma	Betulinic Acid (NPC264317)	NP level
NCT00029679	Borage Oil and Ginkgo Biloba (EGb 761) in Asthma	asthma	Linoleic Acid (NPC85813)	NP level
NCT00346502	Evaluation of 20% Betulinic Acid Ointment for Treatment of Dysplastic Nevi (Moderate to Severe Dysplasia)	dysplastic nevus	Betulinic Acid (NPC264317)	NP level
NCT02063802	Metformin vs Conjugated Linoleic Acid and an Intervention Program With Healthy Habits in Obese Children	obesity	Linoleic Acid (NPC85813)	NP level
NCT00204932	Effects of CLA Supplements on Body Weight and Fat Oxidation	obesity	Linoleic Acid (NPC85813)	NP level
NCT00455416	Dietary Intervention in Follicular Lymphoma	follicular lymphoma	Ellagic Acid (NPC178134)	NP level
NCT02337933	Effect of Ursolic Acid Administration on Insulin Sensitivity and Metabolic Syndrome	metabolic syndrome	Ursolic Acid (NPC51700)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	FFAR4,GALNT2,APEX1,ALOX15,HSD17B10,ACHE,AKR1B1,HPGD
Breast cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C60-2C6Y	EGFR,MET,KDR,IGF1R,TEK,SRC NCT00908791
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	GSTP1,AKR1B1,NUAK1,FABP3,SRC,IGF1R,GPR35
Lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	GSTP1,RORC,KDR,IGF1R,EGFR,MET
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	MET,FFAR4,ACHE,FFAR4,GPR35,F2
Superficial ovarian endometriosis Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA10.B4	GSTP1,LMNA,INSR,SRC,ACHE,FABP3
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	ELAVL3,ALOX15,HPGD,ACHE,KDM4E,GPR35
Colorectal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B91	MET,IGF1R,GSTP1,EGFR,KDR
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	F2,INSR,FFAR1,RELA NCT00607945
Stomach cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72	HSPA1A,EGFR,MET,KDR,HSPA1B
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	INSR,MET,MAOA,KDR,ACHE
Liver cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12	KDR,EGFR,MET,IGF1R,CSNK2A1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	GPR35,AKR1C3,SLC22A6,SRC,AKR1C3
Multiple myeloma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A83	INSR,SRC,KDR,IGF1R
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	RELA,F2,SRC,RORC
Malignant digestive organ neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C11	HSPA1B,SRC,HSPA1A,KDR
Acute diabete complication Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A2Y	AKR1B1,INSR,FFAR1,KDR
Brain cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00	SRC,EGFR,KDR,MET
Pancreatic cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10	EGFR,IGF1R,SRC,GSTP1
Cardiovascular disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA00-BE2Z	KDR,SRC,F2,MET
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	INSR,ACHE,AKR1B1,IGF1R
Melanoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	MET,EGFR,KDR NCT00701987
Motor neuron disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B60	HSPA1A,IGF1R,SRC,HSPA1B
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	MET,RORC,ELAVL3,ACHE
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	GSTP1,FFAR1,IGF1R,FABP3
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	ACHE,GPR35,AKR1C3,F2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	GPR35,EGFR,FFAR1,LMNA
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	MET,KDR,LMNA,POLH
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	MET,FFAR1,FABP3,HPGD
Head and neck cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D42	MET,KDR,EGFR
Retinopathy Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B71	APEX1,TEK,IGF1R
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	SRC,ACHE,MAOA
Renal cell carcinoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90	EGFR,MET,KDR
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	AKR1B1,HSPA1B,HSPA1A
Chronic arterial occlusive disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD4Z	MET,TEK,CES1
Pleomorphic sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B54	SRC,MET,KDR
Metastatic lymph node neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60	KDR,MET,EGFR
Diabetic foot ulcer Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD54	HSPA1A,HSPA1B,EGFR
Myelodysplastic syndrome Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A37	KDR,EGFR,GSTP1
BCR-ABL1-negative chronic myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A41	SRC,HSPA1A,HSPA1B
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	MET,ACHE,AKR1B1
Herpes simplex infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F00	HSPA1B,SMAD3,HSPA1A
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	SRC,KDR,MET
Non-small cell lung cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25	KDR,EGFR,MET
Prostate cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82	AKR1C3,MAOA NCT04403568
Adenocarcinoma of stomach Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B72.0	MET,ALOX15,F2
Malignant neoplasms of oesophagus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B70	ALOX15,HSPA1A,ACHE
Malignant neoplasms of corpus uteri, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.Z	ALOX15,GPR35,F2
Polycystic ovary syndrome Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A80.1	FFAR4,HPGD,POLH
Human immunodeficiency virus disease without mention of tuberculosis or malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C62	GPR35,MET,FFAR1
Peritoneal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C51	SRC,KDR
Gastrointestinal stromal tumour Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5B	SRC,KDR
Thrombocytopenia Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B64	F2,KDR
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	INSR,RELA
Thyroid cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10	MET,KDR
Metastatic malignant neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D50-2E09	HSPA1A,HSPA1B
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	AKR1B1,RELA
Unspecific body region injury Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: ND56	MET,EGFR
Myeloproliferative neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A20	TEK,SRC
Thrombosis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB61-GB90	F2,AKR1B1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	F2 NCT00029679
Substance abuse Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6C40	MAOA,ACHE
Ischemia Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B10-8B11	EGFR,SRC
Angina pectoris Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40	F2,EGFR
Mature B-cell leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A82	SRC,EGFR
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	RELA,RORC
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	SRC,RELA
Chronic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG30	KDR,EGFR
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	INSR,RORC
Metabolic disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C50-5D2Z	NCT04011618,NCT02337933
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	NCT00204932,NCT02063802
Zika virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D48	SMAD3,ACHE
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	AKR1C3,F2
Squamous cell carcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.2	AKR1C3,F2
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	MET,ACHE
Tetralogy of Fallot Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA88.2	RORC,F2
Other specified malignant neoplasms ofcolon Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90.Y	MET,F2
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	ACHE,FFAR1
Malignant neoplasms of thyroid gland, unspecified Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D10.Z	MET,FFAR1
Carpal tunnel syndrome Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C10.0	SMAD3,FFAR4
Ebola virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D60.01	MET,ACHE
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	KDR,NUAK1,ACHE,EGFR,TDP1,TEK,HSD17B10,AKR1B1,LMNA,CSNK2A2,CSNK2A1,SRC,FFAR1,FABP3,POLH,GSTP1,MET,APEX1,RECQL
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	KDR,EGFR,TDP1,GALNT2,LMNA,CSNK2A2,SRC,FFAR1,FFAR4,POLH,GSTP1,MET,APEX1,ALOX15,HPGD,RECQL
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	SRC,MET,APEX1,RORC,EGFR,CSNK2A1,GSTP1,RELA,IGF1R,HSPA1B,KDR,HSPA1A,TEK,POLB
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	GSTP1,MET,FFAR4,NUAK1,FABP3,POLB,LMNA,TEK,ACHE,ALOX15,CES1,AKR1C3,RECQL,F2
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	GSTP1,MET,TDP1,RORC,GALNT2,ELAVL3,POLB,ALOX15,HSD17B10,FFAR4,AKR1B1,FFAR1
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	TDP1,RORC,CSNK2A1,FFAR4,FABP3,POLH,GSTP1,MET,ELAVL3,APEX1,ALOX15,HPGD
Germ cell tumour of testis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80.2	MET,SMAD3,KDR,NUAK1,FABP3,SLC22A6,TEK,ACHE,AKR1B1,HPGD,F2
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	GSTP1,AKR1B1,GPR35,CSNK2A1,SMAD3,NUAK1,ELAVL3,LMNA,SRC,IGF1R
Colon cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B90	EGFR
Nutritional deficiency Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B50-5B71	F2
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	ACHE
Thyrotoxicosis Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A02	IGF1R
Nasopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6B	EGFR
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	RELA
Coronary thrombosis Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA43	F2
Malignant haematopoietic neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B33	SRC
Osteosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B51	SRC
Bleeding disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA20-GA21	F2
Metastatic biliary tract neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C14-2C17	EGFR
Psychotic disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20-6A25	INSR
Liver disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB90-DB9Z	MET
Parasitic worm infestation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F90	ACHE
Hepatitis virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1E50-1E51	EGFR
Mood disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A60-6E23	MAOA
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	RELA
Malignant mesenchymal neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5D-2B5Y	EGFR
Extraocular muscle disorder Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C82	IGF1R
Ischaemic/haemorrhagic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B20	F2
Fallopian tube cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C74	SRC
Biliary tract cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C17	MET
Endometrial cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76	SRC
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	RELA
Coronavirus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D92	CSNK2A1
Multiple structural anomalies syndrome Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD2F	IGF1R
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	RELA
Synovial sarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B5A	SRC
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	AKR1C3
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	ACHE
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	RELA
Skin tag/polyp Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK71	MAOA
Chronic kidney disease Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GB61	IGF1R
Hypopharyngeal cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B6D	EGFR
Mature T-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A90	EGFR
Myocardial infarction Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA41-BA43	F2
Ocular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D00-2D07	APEX1
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	MAOA
Hyper-lipoproteinaemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80	CES1
Skin postprocedural disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EL8Y	EGFR
Lysosomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C56	INSR
NA Disease Category: NA Disease ICD-11 Code: NA	MET
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	RELA
Epidermal dysplasias Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EK90	SRC
Autoimmune disease Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40-4A45	RORC
Leiomyosarcoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2B58	SRC
Ischemic heart disease Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BA40-BA6Z	MET
Coagulation defect Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3B10	F2
Pituitary gland disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A60-5A61	IGF1R
Testicular cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C80	EGFR
Synthesis disorder Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C52-5C59	CES1
Peroxisomal disease Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C57	CES1
Mature B-cell lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A85	TEK
Metastatic digestive system neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D8Y	SRC
Myasthenia gravis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C6Y	ACHE
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	RELA
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	RELA
Pediculosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1G00	ACHE
Intracerebral haemorrhage Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B00	EGFR
Oesophageal/gastroduodenal disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD90	ACHE
Urethral cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C93	EGFR
Digestive organ benign neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2E92	KDR
Cataract Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9B10	AKR1B1
Cervical cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C77	SRC
Idiopathic interstitial pneumonitis Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB03	FFAR1
Depression Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A70-6A7Z	MAOA
Acquired hypomelanotic disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED63	MAOA
Postoperative inflammation Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A00-CA43	SRC
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	ACHE
Spinal cord/cranial nerve neoplasm Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A02	EGFR
Cerebral ischaemic stroke Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8B11	F2
Type-1/2 diabete Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A10-5A11	INSR
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	RELA
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	AKR1B1
Neoplasms Disease Category: 02.Neoplasms Disease ICD-11 Code: 02	NCT00951158
Primary sclerosing cholangitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB96.2	NCT03216876
Follicular lymphoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A80	NCT00455416
Dysplastic naevus Disease Category: X.Extension Codes Disease ICD-11 Code: XH9035	NCT00346502
Dengue fever, unspecified Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D2Z	MAOA
Leishmaniasis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F54	AKR1B1
Myotonic dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C71.0	HPGD
Other specified malignant neoplasms of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.Y	AKR1C3
Urothelial carcinoma of bladder Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C94.2	AKR1B1
Adenocarcinoma of prostate Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C82.0	ALOX15
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	ELAVL3
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	MET
Lyme borreliosis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1C1G	MET
Gliomas of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.0	AKR1C3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Staehelina Fruticosa

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

45 All known Ingredients in Total

34 Ingredients with Acceptable Bioavailablity

31 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Malignant neoplasms of thymus

Breast cancer

Hepatoblastoma

Lung cancer

Other specified malignant neoplasms of kidney, except renal pelvis

Superficial ovarian endometriosis

Cytomegaloviral disease

Colorectal cancer

Type 2 diabetes mellitus

Stomach cancer

Alzheimer disease

Liver cancer

Hepatocellular carcinoma of liver

Multiple myeloma

Multiple sclerosis

Malignant digestive organ neoplasm

Acute diabete complication

Brain cancer

Pancreatic cancer

Cardiovascular disease

Pain, unspecified

Melanoma

Motor neuron disease

Pheochromocytoma

Melanoma of skin

Adenocarcinoma of bronchus or lung

Chikungunya virus disease

Glioblastoma of brain

Malignant neoplasms of adrenal gland

Head and neck cancer

Retinopathy

Parkinsonism

Renal cell carcinoma

Neuropathy

Chronic arterial occlusive disease

Pleomorphic sarcoma

Metastatic lymph node neoplasm

Diabetic foot ulcer

Myelodysplastic syndrome

BCR-ABL1-negative chronic myeloid leukaemia

Glaucoma

Herpes simplex infection

Ovarian cancer

Non-small cell lung cancer

Prostate cancer

Adenocarcinoma of stomach

Malignant neoplasms of oesophagus

Malignant neoplasms of corpus uteri, unspecified

Polycystic ovary syndrome

Human immunodeficiency virus disease without mention of tuberculosis or malaria

Peritoneal cancer

Gastrointestinal stromal tumour

Thrombocytopenia

Diabetes mellitus, type unspecified

Thyroid cancer

Metastatic malignant neoplasm

Rheumatoid arthritis

Unspecific body region injury

Myeloproliferative neoplasm

Thrombosis

Asthma

Substance abuse

Ischemia

Angina pectoris