CMAUP Plant Collective Molecular Activities

Collective Molecular Activities of the Plant: Jatropha Curcas

Example Image

PLANiTS DNA barcode

Click for details-----ITS

GCCCGTTCCGGGGGGTGGGATGTGTTTTTCCTTGGGGGAAAGACATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTCTATCTACGCAAGGGCGAGCTCGGGCGCTTCGGCCCCCGCGCGAGCCCAAAGGCCGAGCCGGGTGCTGCTGGGAAATGCCTCGGCCCTTCCCGCACGCTCGACCCGGTCCACAAACCAACCCCGGCGCAGGACGCGCCAAGGAAACACGAAACGAGAAGAGCACGCGCCCGTCGGCCCCGGAAACGGGCAGCCTCAGGGATGCGCTGTCCTCTATCTATAACCAAAACGACTCTCGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTTCGGCCGAGGGCACGTCTGCCTGGGTGTCACGCAACGTCGCTCCCACCCCGTGTGGGGGCGGATTCTGGCCTCCCGTGCGCCGGTCGGCCGCGGTTGGCCCAAAAGCCTAGTCCCCGGCTGCGAATGCCACGACAATCGGTGGTTGTAAGACCCTCGGACACGGTCGTGCGCGGACGCACGCCCCGGAACATCGAGACCCCTCTGCGTCCCTAAGGGCACGCTCACTCGGAACCCCCCGGGAT

Click for details-----ITS1

AAAGAGAAGGAATTTTACCTGCGGGAAGGATCATTGTCGAAACCTGCACAGCAGAACGACCCGCGAACGCGTCTATCTACGCAAGGGCGAGCTCGGGCGCTTCGGCCCCCGCGCGAGCCCACTGTCCGAGCCGGGTGCTGCTGGGAAATGCCTCGGCCCTTCCCGCACTCTCGACCCGGTCCACGAACCAACCCCGGCGCAGGACGCGCCAAGGAAACACGAAACGAGAAGAGCACGCGCCCGTCGGCCCCGGAAACGGGCAGCCTCAGGGATGCGCTGTCCTCTATCTATAACCAAAA

Click for details-----ITS2

AACGTCGCTCCCACCCCGTGTGGGGAGCGGATTCTGGCCTCCCGTGCGCCGGTCGGCCGCGGTTGGCCCAAAAAGCCTAGTCCCCGGGCTGCGAAATGCCACGAACAAATCGGGTGGTTGTTAAGACCCTCGGGACAACGGTTCGTGCGCGGGACGCACGGCCCCGGAACATCGAGACCCCTCTGCGTCCCTAAGGGCACGCTCACCGGCCCCCCCCCCGGGGGAAAAATAGGGGCGCCCTCGAATTTAAAC

Taxonomic Information

Plant ID: NPO23674
Plant Latin Name: Jatropha Curcas
Taxonomy Genus: Jatropha
Taxonomy Family: Euphorbiaceae

Plant External Links:

NCBI TaxonomyDB: 180498
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:

Brazil; Madagascar; Guinea; Rwanda; Swaziland; Laos; Nigeria; Bolivia; Ghana; Zimbabwe; China; Thailand; Tanzania; Philippines; Indonesia; Vietnam; Angola; Mexico; South Africa; India; Malaysia; Senegal; Congo; Kenya

Traditional Medicine System:

Indian Folk; Unani; Siddha; Ayurveda; TCM; Homeopathy

Geographical Distribution

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

36 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.

28 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Å² < TPSA < 130Å²
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

14 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.

Ingredient Structrual Cards

Ingredient ID: NPC84666

Ingredient ID: NPC7314

Ingredient ID: NPC49389

Ingredient ID: NPC47152

Ingredient ID: NPC44466

Ingredient ID: NPC36108

Ingredient ID: NPC314192

Ingredient ID: NPC310563

Ingredient ID: NPC301585

Ingredient ID: NPC28779

Ingredient ID: NPC283823

Ingredient ID: NPC281020

Ingredient ID: NPC258492

Ingredient ID: NPC246039

Ingredient ID: NPC236579

Ingredient ID: NPC23155

Ingredient ID: NPC223695

Ingredient ID: NPC208075

Ingredient ID: NPC206800

Ingredient ID: NPC205673

Ingredient ID: NPC201859

Ingredient ID: NPC197164

Ingredient ID: NPC180058

Ingredient ID: NPC179694

Ingredient ID: NPC167072

Ingredient ID: NPC161193

Ingredient ID: NPC160858

Ingredient ID: NPC154185

Ingredient ID: NPC149184

Ingredient ID: NPC142753

Ingredient ID: NPC140951

Ingredient ID: NPC138925

Ingredient ID: NPC137167

Ingredient ID: NPC129206

Ingredient ID: NPC111897

Ingredient ID: NPC107482

Classification of Human Proteins Collectively Targeted by the Plant

Target Activity Range: ≤ 1μM Target Type: Individual Protein of Homo sapiens

*The classification criteria of Drug Transporter (DTP), CYP450 are referred to DrugMap. Other molecular targets in CMAUP are classified as therapeutic targets.

Detailed Information of Target Proteins

Target Type	Protein Class	Gene ID	Protein Name	Uniprot ID	Target ChEMBL ID
Therapeutic Target	Phosphodiesterase	TDP1	Tyrosyl-DNA phosphodiesterase 1	Q9NUW8	CHEMBL1075138
Drug Transporter	Potassium channels	KCNH2	HERG	Q12809	CHEMBL240
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM2	Muscarinic acetylcholine receptor M2	P08172	CHEMBL211
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM3	Muscarinic acetylcholine receptor M3	P20309	CHEMBL245
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM4	Muscarinic acetylcholine receptor M4	P08173	CHEMBL1821
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM5	Muscarinic acetylcholine receptor M5	P08912	CHEMBL2035
Therapeutic Target	Small molecule receptor (family A GPCR)	CHRM1	Muscarinic acetylcholine receptor M1	P11229	CHEMBL216
Therapeutic Target	Transcription factor	NFKB1	Nuclear factor NF-kappa-B p105 subunit	P19838	CHEMBL3251

Clinical Trials Summary

Overview

Clinical trials associated with plant from natural product (NP) & plant level:

Clinical trials type	Number of clinical trials
NP level	17

Clinical trial details

NCT ID	Title	Condition	Form in clinical use	Associated by plant or compound
NCT05240456	Beta 3 Agonists in Treatment of Non-neurogenic Voiding Dysfunction in Children	overactive bladder	Solifenacin (NPC314192)	NP level
NCT01871142	Evaluation of the Attenuation by Aes-103 of Hypoxia Mediated Decrements in Endurance Exercise Performance	hypoxia	5-Hydroxymethyl-Furfural (NPC107482)	NP level
NCT01908829	A Trial Comparing Combination Treatment (Solifenacin Plus Mirabegron) With One Treatment Alone (Solifenacin)	overactive bladder	Solifenacin (NPC314192)	NP level
NCT01737411	Surgical vs. Medical Treatment of Urge Urinary Incontinence in Women	Urinary incontinence	Solifenacin (NPC314192)	NP level
NCT03632772	Comparison of Solifenacin and Mirabegron in Treatment of Overactive Bladder Symptoms in Men After TURP	overactive bladder	Solifenacin (NPC314192)	NP level
NCT03566134	A Therapeutic Exploratory Clinical Study of DA-8010 in Patients With Overactive Bladder	overactive bladder	Solifenacin (NPC314192)	NP level
NCT01737918	Treatment of Urge Urinary Incontinence in Women After Failure of Cesa or Vasa	urgency urinary incontinence	Solifenacin (NPC314192)	NP level
NCT04023253	Pharmacologic Effect for Female Overactive Bladder Syndrome: Mirabegron Versus Solifenacin	overactive bladder	Solifenacin (NPC314192)	NP level
NCT02047032	Effect of Electroacupuncture Versus PFMT Plus Solifenacin for Mixed Urinary Incontinence	Urinary incontinence	Solifenacin (NPC314192)	NP level
NCT04090190	Inflammation in Women With Urgency Urinary Incontinence Treated With Anticholinergics	Urinary incontinence	Solifenacin (NPC314192)	NP level
NCT01559389	Incontinence & Intimate Partners: Assessing the Contribution of Treatment	Urinary incontinence	Solifenacin (NPC314192)	NP level
NCT02827578	Efficacy and Safety of Tamsulosin/Solifenacin Combination Therapy in Patients With Voiding Symptoms and Moderate to Severe Storage Symptoms Due to Benign Prostate Hyperplasia	benign prostatic hyperplasia	Solifenacin (NPC314192)	NP level
NCT02805452	Solifenacin Succinate for Treatment of Urinary Toxicity Occurring During Radiotherapy of Prostatic Cancer	overactive bladder	Solifenacin (NPC314192)	NP level
NCT01987908	Evaluation of Different Dose Regimens of Aes-103 Given for 28 Days to Subjects With Stable Sickle Cell Disease	sickle cell anemia	5-Hydroxymethyl-Furfural (NPC107482)	NP level
NCT00821184	Behavioral Modification and Vesicare Versus Vesicare Alone for Urge Incontinence in Patients With Overactive Bladder	overactive bladder	Solifenacin (NPC314192)	NP level
NCT05282069	A Study to Evaluate the Efficacy and Safety of DA-8010 in Patients With Overactive Bladder	overactive bladder	Solifenacin (NPC314192)	NP level
NCT01597401	A Single Dose Study of the Safety, Blood Levels and Biological Effects of Aes-103 Compared to Placebo in Subjects With Stable Sickle Cell Disease	sickle cell anemia	5-Hydroxymethyl-Furfural (NPC107482)	NP level

❱❱❱ Associated Human Diseases and Detailed Association Evidence

How do we define the Plant-Targeted Human Disease Association?
Associated human diseases of an individual plant are summurized based on FOUR types of association evidence, these include:
❶ Association by Therapeutic Target: Bioactive protein targets of the plant were defined in "Molecular Targets" section, target-disease associations collected from TTD database were subsequently used to build the associations between the plant and its targeted human diseases.
❷ Association by Disease Gene Reversion: Plant and a specific disease will be associated when >= 1 plant target gene overlaped with disease's DEGs.
❸ Association by Clinical Trials of Plant: Plant and a specific disease will be associated when >= 1 clinical trial (the plant is the intervetion) can be matched in ClinicalTrials.gov database.
❹ Association by Clinical Trials of Plant Ingredients: Plant and a specific disease will be associated when >= 1 clinical trial (the plant ingredient is the intervetion) can be matched in ClinicalTrials.gov database.

Associated Disease of the Plant	Association Type & Detailed Evidence
Overactive bladder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC50.0	NCT00821184,NCT03632772,NCT05282069,NCT03566134,NCT04023253,NCT01908829,NCT05240456,NCT02805452
Glaucoma Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C61	CHRM3,CHRM2,CHRM5,CHRM4,CHRM1
Urinary incontinence Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF50.2	NCT01737411,NCT01559389,NCT02047032,NCT04090190,NCT01737918
Peptic ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA61	CHRM5,CHRM3,CHRM2,CHRM1
Asthma Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA23	CHRM2,CHRM3,CHRM4,CHRM5
Serous cystadenoma,borderline malignancy of ovary Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73.4	CHRM4,KCNH2,TDP1,CHRM1
Pheochromocytoma Disease Category: X.Extension Codes Disease ICD-11 Code: XH3854	CHRM3,CHRM4,CHRM2,CHRM1
Cytomegaloviral disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D82	CHRM1,CHRM5,CHRM4,KCNH2
Sebaceous gland disorder Disease Category: 14.Diseases of the skin Disease ICD-11 Code: ED91	CHRM2,CHRM1,CHRM3
Irritable bowel syndrome Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD91	NFKB1,CHRM5,CHRM1
Chronic obstructive pulmonary disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CA22	CHRM3,CHRM1,CHRM5
Solid tumour/cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00-2F9Z	NFKB1,CHRM1,CHRM5
Respiratory system disease Disease Category: 12.Diseases of the respiratory system Disease ICD-11 Code: CB40-CB7Z	CHRM4,CHRM2,CHRM3
Functional bladder disorder Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GC50	CHRM3,CHRM5,CHRM1
Abnormal micturition Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF50	CHRM5,CHRM2,CHRM1
Carcinosarcoma of uterus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C76.43	CHRM4,TDP1,CHRM1
Mesothelioma of pleura Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C26.0	CHRM4,TXNRD3,TDP1
Hepatocellular carcinoma of liver Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.02	CHRM3,KCNH2,KCNH2
Malignant neoplasms of adrenal gland Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D11	CHRM3,CHRM2,KCNH2
Tonus and reflex abnormality Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB47	CHRM3,CHRM5
Multiple sclerosis Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A40	NFKB1,KCNH2
Pain, unspecified Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MG3Z	KCNH2,CHRM5
Parkinsonism Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A00	CHRM5,CHRM1
Nausea/vomiting Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD90	CHRM3,CHRM4
Sickle-cell disorder Disease Category: 03.Diseases of the blood or blood-forming organs Disease ICD-11 Code: 3A51	NCT01597401,NCT01987908
Hepatoblastoma Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C12.01	CHRM3,KCNH2
Diffuse large B-cell lymphomas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A81	TXNRD3,TDP1
Adenocarcinoma of pancreas Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C10.0	CHRM4,KCNH2
Malignant neoplasms of thymus Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C27	NFKB1,KCNH2
Renal cell carcinoma, chromophobe type Disease Category: X.Extension Codes Disease ICD-11 Code: XH6153	KCNH2,CHRM1
Dementia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D80-6D8Z	CHRM1
Mild neurocognitive disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6D71	CHRM1
Malaria Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F40-1F45	KCNH2
Muscular dystrophy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70	NFKB1
Schizophrenia Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A20	CHRM1
Corneal disease Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A76-9A78	CHRM1
Hyperhidrosis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EE00	CHRM1
Digestive system disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DE2Z	CHRM5
Psoriasis Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA90	NFKB1
Type 2 diabetes mellitus Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A11	NFKB1
Acute/subacute hepatic failure Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DB91	NFKB1
Intellectual development disorder Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LD90	CHRM1
Polyuria Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MF55	CHRM5
Fungal infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F29-1F2F	NFKB1
Rheumatoid arthritis Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FA20	NFKB1
Female pelvic pain Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA34	CHRM5
Unspecific substance harmful effect Disease Category: 22.Injury, poisoning or certain other consequences of external causes Disease ICD-11 Code: NE6Z	CHRM5
Cognition symptoms/signs/clinical sympton Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB21	CHRM5
Choreiform disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A01	NFKB1
Eye anterior segment structural developmental anomaly Disease Category: 20.Developmental anomalies Disease ICD-11 Code: LA11	CHRM4
Diabetes mellitus, type unspecified Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5A14	NFKB1
Ovarian cancer Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C73	TNKS
Acute myeloid leukaemia Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A60	NFKB1
Dystonic disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A02	CHRM1
Gastritis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA42	CHRM5
Appearance/behaviour symptom Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MB23	CHRM5
Skin and skin-structure infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1F28-1G0Z	NFKB1
Nystagmus Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9C84	CHRM5
Lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40	NFKB1
Gastric ulcer Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA60	CHRM1
Cough Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD12	CHRM5
Muscle disorder Disease Category: 15.Diseases of the musculoskeletal system or connective tissue Disease ICD-11 Code: FB32-FB3Z	CHRM2
Abdominal pelvic pain Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD81	CHRM1
General examination Disease Category: 24.Factors influencing health status or contact with health services Disease ICD-11 Code: QA00	CHRM5
Infectious gastroenteritis/colitis Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1A40	CHRM5
Obesity Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5B80-5B81	CHRM1
Pancreatitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DC31-DC34	CHRM5
Brain disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C70-8E61	CHRM5
Central and peripheral nervous disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A04-8E7Z	CHRM5
Schizoaffective disorder Disease Category: 06.Mental, behavioural or neurodevelopmental disorders Disease ICD-11 Code: 6A21	CHRM1
Oesophagus motility disorder Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DA21	CHRM5
Sleep-wake disorder Disease Category: 07.Sleep-wake disorders Disease ICD-11 Code: 7A00-7B2Z	KCNH2
Atopic eczema Disease Category: 14.Diseases of the skin Disease ICD-11 Code: EA80	NFKB1
Neuropathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8C0Z	CHRM1
Dyslipidemia Disease Category: 05.Endocrine, nutritional or metabolic diseases Disease ICD-11 Code: 5C80-5C81	CHRM1
Alzheimer disease Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A20	CHRM1
Anterior uveitis Disease Category: 09.Diseases of the visual system Disease ICD-11 Code: 9A96	CHRM5
Heart failure Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BD10-BD1Z	KCNH2
Pulmonary hypertension Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BB01	CHRM5
Indeterminate colitis Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD72	NFKB1
Sjogren syndrome Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A43	CHRM3
Epileptic encephalopathy Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8A62	CHRM1
General pain disorder Disease Category: 08.Diseases of the nervous system Disease ICD-11 Code: 8E43	CHRM1
Urgency Disease Category: NA Disease ICD-11 Code: N.A.	CHRM5
Asphyxia Disease Category: 21.Symptoms, signs or clinical findings, not elsewhere classified Disease ICD-11 Code: MD11.1	NCT01871142
Prostate hyperplasia Disease Category: 16.Diseases of the genitourinary system Disease ICD-11 Code: GA90	NCT02827578
Crohn disease Disease Category: 13.Diseases of the digestive system Disease ICD-11 Code: DD70	CHRM4
Hypertrophic cardiomyopathy Disease Category: 11.Diseases of the circulatory system Disease ICD-11 Code: BC43.1	CHRM3
Malignant neoplasms of biliary tract, distal bile duct Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C15	KCNH2
Malignant neoplasm metastasis in lymph nodes of head, face or neck Disease Category: 02.Neoplasms Disease ICD-11 Code: 2D60.0	CHRM5
Other specified malignant neoplasms of kidney, except renal pelvis Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C90.Y	KCNH2
West Nile virus infection Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D46	NFKB1
Melanoma of skin Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C30	KCNH2
Systemic lupus erythematosus Disease Category: 04.Diseases of the immune system Disease ICD-11 Code: 4A40.0	CHRM5
Adenocarcinoma of bronchus or lung Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C25.0	KCNH2
Chikungunya virus disease Disease Category: 01.Certain infectious or parasitic diseases Disease ICD-11 Code: 1D40	CHRM4
Invasive carcinoma of breast Disease Category: 02.Neoplasms Disease ICD-11 Code: 2C61	KCNH2
Glioblastoma of brain Disease Category: 02.Neoplasms Disease ICD-11 Code: 2A00.00	TXNRD3

❱❱❱ Network Visualization of Plant-Targeted Human Disease Associations

Plant-Targeted Human Disease Network

Data Section	Select to Download
1. General Info & Plant Usage & Geographical Distribution
2. Plant Ingredients
3. Collective Molecular Proteins
4. Collective Enriched Activities
5. Plant molecular targets overlapping with DEGs
6. Associated clinical trials
7. Associated Human Diseases

Collective Molecular Activities of the Plant: Jatropha Curcas

Click for details-----ITS

Click for details-----ITS1

Click for details-----ITS2

Plant External Links:

Country/Region:

Traditional Medicine System:

See the Plant Occurrence Worldwide with Latitude and Longitude Available

Overview of Ingredients

36 All known Ingredients in Total

28 Ingredients with Acceptable Bioavailablity

14 Ingredients with experimental-derived Activity

Ingredient Structrual Cards

Classification of Human Proteins Collectively Targeted by the Plant

Detailed Information of Target Proteins

❱❱❱ Associated Human Diseases and Detailed Association Evidence

Associated Disease of the Plant

Association Type & Detailed Evidence

Overactive bladder

Glaucoma

Urinary incontinence

Peptic ulcer

Asthma

Serous cystadenoma,borderline malignancy of ovary

Pheochromocytoma

Cytomegaloviral disease

Sebaceous gland disorder

Irritable bowel syndrome

Chronic obstructive pulmonary disease

Solid tumour/cancer

Respiratory system disease

Functional bladder disorder

Abnormal micturition

Carcinosarcoma of uterus

Mesothelioma of pleura

Hepatocellular carcinoma of liver

Malignant neoplasms of adrenal gland

Tonus and reflex abnormality

Multiple sclerosis

Pain, unspecified

Parkinsonism

Nausea/vomiting

Sickle-cell disorder

Hepatoblastoma

Diffuse large B-cell lymphomas

Adenocarcinoma of pancreas

Malignant neoplasms of thymus

Renal cell carcinoma, chromophobe type

Dementia

Mild neurocognitive disorder

Malaria

Muscular dystrophy

Schizophrenia

Corneal disease

Hyperhidrosis

Digestive system disease

Psoriasis

Type 2 diabetes mellitus

Acute/subacute hepatic failure

Intellectual development disorder

Polyuria

Fungal infection

Rheumatoid arthritis

Female pelvic pain

Unspecific substance harmful effect

Cognition symptoms/signs/clinical sympton

Choreiform disorder

Eye anterior segment structural developmental anomaly

Diabetes mellitus, type unspecified

Ovarian cancer

Acute myeloid leukaemia

Dystonic disorder

Gastritis

Appearance/behaviour symptom

Skin and skin-structure infection

Nystagmus

Lupus erythematosus

Gastric ulcer

Cough

Muscle disorder