• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Imperata Cylindrica


Example Image
PLANiTS DNA barcode

Click for details-----ITS

TTTCCATAGGTGAACTTGTGGAAGGATCATTGTCGTGACCCTTAAACAAAACAGACCGTGAACGAGTCTCTCGTGCCGCTGGGCTCCGGCCCGGCCAAGGCCCCCGAGCTCCGTCCCGGGGCAGAGGGGCCACAACAGAACCCACATCGTCTAAGGCATCAAGGAACACTTCTATTTCCTTGCTCGGCAGAGCGGTCGGCCTGCCTTCCGCTCCTCGCGCAGCGATGATATCTTAATGAACACGACTCTCGGCAATGGATATCTCAGCTCTCGCATCGATGAAGAACGTAGCAAAATGCGGTACCTGGTGTGAATTGCAAAATCCCGCGAACCATTGAGTTTTTGAACGCAAGTTGCGCCCGAGGCCTTCTGATCGAGGGCACGTCTGCCTGGGCGTCACGCCAAAAGACACTCCCAACCCACCCTCGAGGAGGGATGTGGTGTTTGGACCCCCGCGCCGCAGGGTGCGGTGGGCCGAAGTTGGGGCTGCAGGCAAACTGTGTCGGGCACAGCACGTGGTGGGCGACATCAGTTGTTCTCGGTGCAGCGCCACGGCGCGCGGCCGGCGTGTCGGCCCTAAGGACCCATCGAGCACCGCAGCGCATCGCCGCTCGGACCGTGACCCCAGGTCAGTCGAGACTAGCCG

Click for details-----ITS1

TTTCCATAGGTGAACTTGTGGAAGGATCATTGTCGTGACCCTTAAACAAAACAGACCGTGAACGAGTCTCTCGTGCCGCTGGGCTCCGGCCCGGCCAAGGCCCCCGAGCTCCGTCCCGGGGCAGAGGGGCCACAACAGAACCCACATCGTCTAAGGCATCAAGGAACACTTCTATTTCCTTGCTCGGCAGAGCGGTCGGCCTGCCTTCCGCTCCTCGCGCAGCGATGATATCTTAATGAACA

Click for details-----ITS2

CAAAAGACACTCCCAACCCACCCTCGGGGAGGGACGTGGTGTTTGGACCCCCGCGCCGCAGGGCGCGGTGGGCCGAAGTTGGGGCTGCCGGCGAACCGTGYCGGGCACAGCACGTGGTGGGCGACATCAGTTGTTCTCGGTGCAGCGCCCCGGCGCGCGGCCGGCGCGTCGGCCCTAAGGACCCATCGAGCACCGCAGCGCATTGATTTAATTTACGTGTCAACTGTGCAGTGCATTTTACTGTTGGTCGTTTTAAGGCTCCAAGCTTTCTCTTCTTTAATTTGCTACTGACATCTGCTACTTTGATTGTGATGGGAGGCCCACTTTGCCCA
Taxonomic Information

Plant ID: NPO23628
Plant Latin Name: Imperata Cylindrica
Taxonomy Genus: Imperata
Taxonomy Family: Poaceae

Plant External Links:

NCBI TaxonomyDB: 80369
Plant-of-the-World-Online: n.a.

Used in Medicines

Country/Region:
Australia; Guinea; Tanzania; Indonesia; India; Laos; Malaysia; Rwanda; China; Vietnam; Thailand; Kenya; South Korea; Philippines

Traditional Medicine System:
Indian Folk; TCM; Ayurveda; Siddha


Medicinal Functions:

Anthelmintic; Antibacterial; Antivinous; Astringent; Cancer; Diuretic; Emollient; Febrifuge; Restorative; Sialagogue; Styptic; Tonic

Geographical Distribution

Australia; Guinea; Philippines; Indonesia; India; Malaysia; Rwanda; China; Vietnam; Laos; Kenya; South Korea; Tanzania; Thailand

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

131 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


129 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

77 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC95981

Ingredient ID: NPC95755

Ingredient ID: NPC93653

Ingredient ID: NPC87237

Ingredient ID: NPC85813

Ingredient ID: NPC82714

Ingredient ID: NPC81010

Ingredient ID: NPC8005

Ingredient ID: NPC76336

Ingredient ID: NPC74539

Ingredient ID: NPC74458

Ingredient ID: NPC7370

Ingredient ID: NPC70744

Ingredient ID: NPC70290

Ingredient ID: NPC6868

Ingredient ID: NPC63012

Ingredient ID: NPC62765

Ingredient ID: NPC61274

Ingredient ID: NPC5476

Ingredient ID: NPC54243

Ingredient ID: NPC47017

Ingredient ID: NPC45084

Ingredient ID: NPC42591

Ingredient ID: NPC41721

Ingredient ID: NPC41178

Ingredient ID: NPC39753

Ingredient ID: NPC36108

Ingredient ID: NPC34770

Ingredient ID: NPC32977

Ingredient ID: NPC329069

Ingredient ID: NPC328151

Ingredient ID: NPC326065

Ingredient ID: NPC32163

Ingredient ID: NPC317201

Ingredient ID: NPC31557

Ingredient ID: NPC31504

Ingredient ID: NPC307063

Ingredient ID: NPC306478

Ingredient ID: NPC301585

Ingredient ID: NPC299582

Ingredient ID: NPC29883

Ingredient ID: NPC297423

Ingredient ID: NPC296697

Ingredient ID: NPC295691

Ingredient ID: NPC290613

Ingredient ID: NPC29

Ingredient ID: NPC287382

Ingredient ID: NPC287152

Ingredient ID: NPC283823

Ingredient ID: NPC281835

Ingredient ID: NPC279026

Ingredient ID: NPC278726

Ingredient ID: NPC27633

Ingredient ID: NPC274839

Ingredient ID: NPC274613

Ingredient ID: NPC266726

Ingredient ID: NPC263265

Ingredient ID: NPC261080

Ingredient ID: NPC258425

Ingredient ID: NPC258298

Ingredient ID: NPC257490

Ingredient ID: NPC255322

Ingredient ID: NPC252821

Ingredient ID: NPC250476

Ingredient ID: NPC246358

Ingredient ID: NPC23610

Ingredient ID: NPC234536

Ingredient ID: NPC23387

Ingredient ID: NPC233731

Ingredient ID: NPC231890

Ingredient ID: NPC230301

Ingredient ID: NPC226712

Ingredient ID: NPC223697

Ingredient ID: NPC220408

Ingredient ID: NPC216630

Ingredient ID: NPC214919

Ingredient ID: NPC211885

Ingredient ID: NPC211729

Ingredient ID: NPC210460

Ingredient ID: NPC209970

Ingredient ID: NPC209712

Ingredient ID: NPC208760

Ingredient ID: NPC206800

Ingredient ID: NPC204442

Ingredient ID: NPC203950

Ingredient ID: NPC203719

Ingredient ID: NPC201844

Ingredient ID: NPC196924

Ingredient ID: NPC189095

Ingredient ID: NPC184774

Ingredient ID: NPC173319

Ingredient ID: NPC171280

Ingredient ID: NPC169207

Ingredient ID: NPC166591

Ingredient ID: NPC164706

Ingredient ID: NPC164469

Ingredient ID: NPC163497

Ingredient ID: NPC157192

Ingredient ID: NPC156655

Ingredient ID: NPC156654

Ingredient ID: NPC155498

Ingredient ID: NPC154186

Ingredient ID: NPC153690

Ingredient ID: NPC145853

Ingredient ID: NPC145729

Ingredient ID: NPC144682

Ingredient ID: NPC144416

Ingredient ID: NPC14227

Ingredient ID: NPC140703

Ingredient ID: NPC138805

Ingredient ID: NPC137877

Ingredient ID: NPC137264

Ingredient ID: NPC137157

Ingredient ID: NPC131885

Ingredient ID: NPC127462

Ingredient ID: NPC127343

Ingredient ID: NPC125570

Ingredient ID: NPC125417

Ingredient ID: NPC123353

Ingredient ID: NPC122483

Ingredient ID: NPC120942

Ingredient ID: NPC118418

Ingredient ID: NPC115998

Ingredient ID: NPC114464

Ingredient ID: NPC111888

Ingredient ID: NPC110899

Ingredient ID: NPC108612

Ingredient ID: NPC107482

Ingredient ID: NPC105317

Ingredient ID: NPC100899

Ingredient ID: NPC100449