• Home
  • About
  • Browse
  • Help
  • Download

Collective Molecular Activities of the Plant: Erysimum Siliculosum


Example Image
PLANiTS DNA barcode

Click for details-----ITS

NA

Click for details-----ITS1

TCGATACCTGTCCAAAACAGAACGACCCGTGAACTAACGATCACTACTCACGGTAAGCCGGGTTCTTAGTCGAYCCCGTGCTTGCCGAATCCGTGGTTTCGCATGTTGTCCAGATCGAGAGTAATGTTTCGGTCTGGTCATATGCGTTGCTTCCGGATATCACAAAACCACGGCACGAAAAGTGTCAAGGAACATATAACCGAACAGCCTGCATTCGTCGACCCGGAGACGGTGTTTGTGCGGATGCTGTGCTGCGATCTAAAGTCTAAAA

Click for details-----ITS2

NA
Taxonomic Information

Plant ID: NPO23549
Plant Latin Name: Erysimum Siliculosum
Taxonomy Genus: Erysimum
Taxonomy Family: Brassicaceae

Plant External Links:

NCBI TaxonomyDB: 537132
Plant-of-the-World-Online: 284170-1

Used in Medicines

Unknown.

Geographical Distribution

Ukraine; Kazakhstan; China; Russia; Turkmenistan

Geographical Distribution
See the Plant Occurrence Worldwide with Latitude and Longitude Available

Compounds Summary

Overview of Ingredients

14 All known Ingredients in Total

Unique ingredients have been isolated from this plant.
Plant-Ingredients Associations were manually curated from publications or collected from other databases.


9 Ingredients with Acceptable Bioavailablity

Unique ingredients exhibit acceptable human oral bioavailablity, according to the criteria of SwissADME [PMID: 28256516] and HobPre [PMID: 34991690]. The criteria details:

SwissADME: six descriptors are used by SwissADME to evaluate the oral bioavailability of a natural product:
  ☑ LIPO(Lipophility): -0.7 < XLOGP3 < +5.0
  ☑ SIZE: 150g/mol < MW < 500g/mol
  ☑ POLAR(Polarity): 20Ų < TPSA < 130Ų
  ☑ INSOLU(Insolubility): -6 < Log S (ESOL) < 0
  ☑ INSATU(Insaturation): 0.25 < Fraction Csp3 < 1
  ☑ FLEX(Flexibility): 0 < Num. rotatable bonds < 9

If 6 descriptors of a natural plant satisfy the above rules, it will be labeled high HOB.
HobPre: A natural plant ingredient with HobPre score >0.5 is labeled high human oral availability (HOB)

12 Ingredients with experimental-derived Activity

Unique ingredients have activity data available.






Ingredient Structrual Cards


Ingredient ID: NPC79056

Ingredient ID: NPC78540

Ingredient ID: NPC50898

Ingredient ID: NPC43763

Ingredient ID: NPC39426

Ingredient ID: NPC313163

Ingredient ID: NPC294852

Ingredient ID: NPC284556

Ingredient ID: NPC279121

Ingredient ID: NPC257756

Ingredient ID: NPC233824

Ingredient ID: NPC192638

Ingredient ID: NPC117418

Ingredient ID: NPC116775